ID: 982787525

View in Genome Browser
Species Human (GRCh38)
Location 4:159553385-159553407
Sequence TGCCATCTGGACACCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982787525_982787528 -8 Left 982787525 4:159553385-159553407 CCTGTGTAGGTGTCCAGATGGCA No data
Right 982787528 4:159553400-159553422 AGATGGCAACCAGGTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982787525 Original CRISPR TGCCATCTGGACACCTACAC AGG (reversed) Intergenic
No off target data available for this crispr