ID: 982794731

View in Genome Browser
Species Human (GRCh38)
Location 4:159630982-159631004
Sequence GCTTTGTTTATATATCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982794731_982794735 30 Left 982794731 4:159630982-159631004 CCAGACTGATATATAAACAAAGC No data
Right 982794735 4:159631035-159631057 GCCTGTAATTTCAGCACTTTGGG 0: 544
1: 22085
2: 252104
3: 275175
4: 174741
982794731_982794734 29 Left 982794731 4:159630982-159631004 CCAGACTGATATATAAACAAAGC No data
Right 982794734 4:159631034-159631056 CGCCTGTAATTTCAGCACTTTGG 0: 205
1: 10661
2: 154148
3: 290702
4: 214637
982794731_982794733 2 Left 982794731 4:159630982-159631004 CCAGACTGATATATAAACAAAGC No data
Right 982794733 4:159631007-159631029 TGAAAATGAGTCGTGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982794731 Original CRISPR GCTTTGTTTATATATCAGTC TGG (reversed) Intergenic
No off target data available for this crispr