ID: 982796560

View in Genome Browser
Species Human (GRCh38)
Location 4:159653254-159653276
Sequence CCTTCTGAATTGAAGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982796560_982796563 -4 Left 982796560 4:159653254-159653276 CCCTGTCACTTCAATTCAGAAGG No data
Right 982796563 4:159653273-159653295 AAGGCCTTCGAGTATCTTTTTGG No data
982796560_982796567 23 Left 982796560 4:159653254-159653276 CCCTGTCACTTCAATTCAGAAGG No data
Right 982796567 4:159653300-159653322 CACTATTTTGCACTGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982796560 Original CRISPR CCTTCTGAATTGAAGTGACA GGG (reversed) Intergenic
No off target data available for this crispr