ID: 982797966

View in Genome Browser
Species Human (GRCh38)
Location 4:159668345-159668367
Sequence CACTGAAGCCATTTTAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982797963_982797966 -3 Left 982797963 4:159668325-159668347 CCCTTATCTAGGCCTGTGGTCAC No data
Right 982797966 4:159668345-159668367 CACTGAAGCCATTTTAGCACTGG No data
982797964_982797966 -4 Left 982797964 4:159668326-159668348 CCTTATCTAGGCCTGTGGTCACT No data
Right 982797966 4:159668345-159668367 CACTGAAGCCATTTTAGCACTGG No data
982797960_982797966 22 Left 982797960 4:159668300-159668322 CCAAGAATTCAGAGGGGATTGAG No data
Right 982797966 4:159668345-159668367 CACTGAAGCCATTTTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982797966 Original CRISPR CACTGAAGCCATTTTAGCAC TGG Intergenic