ID: 982802266

View in Genome Browser
Species Human (GRCh38)
Location 4:159720010-159720032
Sequence GTGTGGCTACGGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982802258_982802266 19 Left 982802258 4:159719968-159719990 CCAGGAAGGACTTGGTATACTGG No data
Right 982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG No data
982802256_982802266 27 Left 982802256 4:159719960-159719982 CCTTGATTCCAGGAAGGACTTGG No data
Right 982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982802266 Original CRISPR GTGTGGCTACGGAGTGAGGA TGG Intergenic
No off target data available for this crispr