ID: 982802995 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:159727187-159727209 |
| Sequence | CCATACTCAAGATGGGCATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982802995_982803001 | 6 | Left | 982802995 | 4:159727187-159727209 | CCAAATGCCCATCTTGAGTATGG | No data | ||
| Right | 982803001 | 4:159727216-159727238 | TGGGTCCATTTTGTCCAACTTGG | No data | ||||
| 982802995_982803003 | 12 | Left | 982802995 | 4:159727187-159727209 | CCAAATGCCCATCTTGAGTATGG | No data | ||
| Right | 982803003 | 4:159727222-159727244 | CATTTTGTCCAACTTGGATCAGG | No data | ||||
| 982802995_982803004 | 19 | Left | 982802995 | 4:159727187-159727209 | CCAAATGCCCATCTTGAGTATGG | No data | ||
| Right | 982803004 | 4:159727229-159727251 | TCCAACTTGGATCAGGAGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982802995 | Original CRISPR | CCATACTCAAGATGGGCATT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||