ID: 982802995

View in Genome Browser
Species Human (GRCh38)
Location 4:159727187-159727209
Sequence CCATACTCAAGATGGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982802995_982803001 6 Left 982802995 4:159727187-159727209 CCAAATGCCCATCTTGAGTATGG No data
Right 982803001 4:159727216-159727238 TGGGTCCATTTTGTCCAACTTGG No data
982802995_982803003 12 Left 982802995 4:159727187-159727209 CCAAATGCCCATCTTGAGTATGG No data
Right 982803003 4:159727222-159727244 CATTTTGTCCAACTTGGATCAGG No data
982802995_982803004 19 Left 982802995 4:159727187-159727209 CCAAATGCCCATCTTGAGTATGG No data
Right 982803004 4:159727229-159727251 TCCAACTTGGATCAGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982802995 Original CRISPR CCATACTCAAGATGGGCATT TGG (reversed) Intergenic
No off target data available for this crispr