ID: 982803524

View in Genome Browser
Species Human (GRCh38)
Location 4:159734193-159734215
Sequence TCAAGTCTGTCAAAAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982803524_982803527 12 Left 982803524 4:159734193-159734215 CCTGGACTTTTTGACAGACTTGA No data
Right 982803527 4:159734228-159734250 AGAAACAAGTCATACCTACTTGG No data
982803524_982803528 24 Left 982803524 4:159734193-159734215 CCTGGACTTTTTGACAGACTTGA No data
Right 982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982803524 Original CRISPR TCAAGTCTGTCAAAAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr