ID: 982803526

View in Genome Browser
Species Human (GRCh38)
Location 4:159734226-159734248
Sequence AAGTAGGTATGACTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982803526_982803530 26 Left 982803526 4:159734226-159734248 CCAGAAACAAGTCATACCTACTT No data
Right 982803530 4:159734275-159734297 CAGTCTGTCAGCTACCTTTGTGG No data
982803526_982803528 -9 Left 982803526 4:159734226-159734248 CCAGAAACAAGTCATACCTACTT No data
Right 982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982803526 Original CRISPR AAGTAGGTATGACTTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr