ID: 982803528 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:159734240-159734262 |
| Sequence | TACCTACTTGGTGTTCAGTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982803525_982803528 | -3 | Left | 982803525 | 4:159734220-159734242 | CCTTTTCCAGAAACAAGTCATAC | No data | ||
| Right | 982803528 | 4:159734240-159734262 | TACCTACTTGGTGTTCAGTTTGG | No data | ||||
| 982803526_982803528 | -9 | Left | 982803526 | 4:159734226-159734248 | CCAGAAACAAGTCATACCTACTT | No data | ||
| Right | 982803528 | 4:159734240-159734262 | TACCTACTTGGTGTTCAGTTTGG | No data | ||||
| 982803524_982803528 | 24 | Left | 982803524 | 4:159734193-159734215 | CCTGGACTTTTTGACAGACTTGA | No data | ||
| Right | 982803528 | 4:159734240-159734262 | TACCTACTTGGTGTTCAGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982803528 | Original CRISPR | TACCTACTTGGTGTTCAGTT TGG | Intergenic | ||
| No off target data available for this crispr | |||||