ID: 982803528

View in Genome Browser
Species Human (GRCh38)
Location 4:159734240-159734262
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982803526_982803528 -9 Left 982803526 4:159734226-159734248 CCAGAAACAAGTCATACCTACTT No data
Right 982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG No data
982803524_982803528 24 Left 982803524 4:159734193-159734215 CCTGGACTTTTTGACAGACTTGA No data
Right 982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG No data
982803525_982803528 -3 Left 982803525 4:159734220-159734242 CCTTTTCCAGAAACAAGTCATAC No data
Right 982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type