ID: 982806158

View in Genome Browser
Species Human (GRCh38)
Location 4:159766442-159766464
Sequence ATTGGCTGCAGCTTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982806153_982806158 15 Left 982806153 4:159766404-159766426 CCTTATGTTCACATGGTCTGATC No data
Right 982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982806158 Original CRISPR ATTGGCTGCAGCTTGGCTGC TGG Intergenic
No off target data available for this crispr