ID: 982823562

View in Genome Browser
Species Human (GRCh38)
Location 4:159974679-159974701
Sequence CACCCACGAATGCTATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982823562_982823566 23 Left 982823562 4:159974679-159974701 CCCTGCTATAGCATTCGTGGGTG No data
Right 982823566 4:159974725-159974747 CCTGCAAATGCGTACGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982823562 Original CRISPR CACCCACGAATGCTATAGCA GGG (reversed) Intergenic
No off target data available for this crispr