ID: 982825505

View in Genome Browser
Species Human (GRCh38)
Location 4:159999450-159999472
Sequence CTGTGGTATCACTGAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982825500_982825505 15 Left 982825500 4:159999412-159999434 CCAATTTATAGCTTTAGGAAGGG No data
Right 982825505 4:159999450-159999472 CTGTGGTATCACTGAGTTGAGGG No data
982825496_982825505 29 Left 982825496 4:159999398-159999420 CCCAGAGGTGGTGACCAATTTAT No data
Right 982825505 4:159999450-159999472 CTGTGGTATCACTGAGTTGAGGG No data
982825497_982825505 28 Left 982825497 4:159999399-159999421 CCAGAGGTGGTGACCAATTTATA No data
Right 982825505 4:159999450-159999472 CTGTGGTATCACTGAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982825505 Original CRISPR CTGTGGTATCACTGAGTTGA GGG Intergenic
No off target data available for this crispr