ID: 982827479

View in Genome Browser
Species Human (GRCh38)
Location 4:160019134-160019156
Sequence AAGCTGAGCCTGCTGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982827479_982827484 29 Left 982827479 4:160019134-160019156 CCCATTTCCAGCAGGCTCAGCTT No data
Right 982827484 4:160019186-160019208 CTGCAGCCAGACACCAGGCCTGG No data
982827479_982827482 -5 Left 982827479 4:160019134-160019156 CCCATTTCCAGCAGGCTCAGCTT No data
Right 982827482 4:160019152-160019174 AGCTTTGTGTGTTGCTTCTGAGG No data
982827479_982827483 24 Left 982827479 4:160019134-160019156 CCCATTTCCAGCAGGCTCAGCTT No data
Right 982827483 4:160019181-160019203 AGTATCTGCAGCCAGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982827479 Original CRISPR AAGCTGAGCCTGCTGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr