ID: 982828380

View in Genome Browser
Species Human (GRCh38)
Location 4:160028095-160028117
Sequence CACAGCAGGCTGAAGTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982828380_982828386 19 Left 982828380 4:160028095-160028117 CCAAAGCACTTCAGCCTGCTGTG No data
Right 982828386 4:160028137-160028159 TGAAGTTCAAGCTACTGGGCTGG No data
982828380_982828385 15 Left 982828380 4:160028095-160028117 CCAAAGCACTTCAGCCTGCTGTG No data
Right 982828385 4:160028133-160028155 AAACTGAAGTTCAAGCTACTGGG No data
982828380_982828387 20 Left 982828380 4:160028095-160028117 CCAAAGCACTTCAGCCTGCTGTG No data
Right 982828387 4:160028138-160028160 GAAGTTCAAGCTACTGGGCTGGG No data
982828380_982828384 14 Left 982828380 4:160028095-160028117 CCAAAGCACTTCAGCCTGCTGTG No data
Right 982828384 4:160028132-160028154 GAAACTGAAGTTCAAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982828380 Original CRISPR CACAGCAGGCTGAAGTGCTT TGG (reversed) Intergenic
No off target data available for this crispr