ID: 982828387

View in Genome Browser
Species Human (GRCh38)
Location 4:160028138-160028160
Sequence GAAGTTCAAGCTACTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982828380_982828387 20 Left 982828380 4:160028095-160028117 CCAAAGCACTTCAGCCTGCTGTG No data
Right 982828387 4:160028138-160028160 GAAGTTCAAGCTACTGGGCTGGG No data
982828383_982828387 6 Left 982828383 4:160028109-160028131 CCTGCTGTGGTGAGGCGTGCTGA No data
Right 982828387 4:160028138-160028160 GAAGTTCAAGCTACTGGGCTGGG No data
982828379_982828387 21 Left 982828379 4:160028094-160028116 CCCAAAGCACTTCAGCCTGCTGT No data
Right 982828387 4:160028138-160028160 GAAGTTCAAGCTACTGGGCTGGG No data
982828378_982828387 22 Left 982828378 4:160028093-160028115 CCCCAAAGCACTTCAGCCTGCTG No data
Right 982828387 4:160028138-160028160 GAAGTTCAAGCTACTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982828387 Original CRISPR GAAGTTCAAGCTACTGGGCT GGG Intergenic
No off target data available for this crispr