ID: 982829944

View in Genome Browser
Species Human (GRCh38)
Location 4:160046447-160046469
Sequence TCTCATAAACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982829941_982829944 -7 Left 982829941 4:160046431-160046453 CCTAACACATAAGGACTCTCATA No data
Right 982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG No data
982829939_982829944 22 Left 982829939 4:160046402-160046424 CCAAGTATCTGCTGTCTTCAGGA 0: 7
1: 217
2: 457
3: 639
4: 1066
Right 982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG No data
982829937_982829944 26 Left 982829937 4:160046398-160046420 CCAACCAAGTATCTGCTGTCTTC 0: 111
1: 283
2: 408
3: 366
4: 380
Right 982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982829944 Original CRISPR TCTCATAAACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr