ID: 982831590

View in Genome Browser
Species Human (GRCh38)
Location 4:160067990-160068012
Sequence GGCGGTGAGGAAGCCTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831590_982831596 -9 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831596 4:160068004-160068026 CTCACCGCCATGGGGGCCTCAGG No data
982831590_982831601 7 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831601 4:160068020-160068042 CCTCAGGGCTCCAACTGATCAGG No data
982831590_982831602 8 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831602 4:160068021-160068043 CTCAGGGCTCCAACTGATCAGGG No data
982831590_982831597 -8 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831597 4:160068005-160068027 TCACCGCCATGGGGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831590 Original CRISPR GGCGGTGAGGAAGCCTAAAC TGG (reversed) Intergenic