ID: 982831595

View in Genome Browser
Species Human (GRCh38)
Location 4:160068003-160068025
Sequence CTGAGGCCCCCATGGCGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831595_982831601 -6 Left 982831595 4:160068003-160068025 CCTCACCGCCATGGGGGCCTCAG No data
Right 982831601 4:160068020-160068042 CCTCAGGGCTCCAACTGATCAGG No data
982831595_982831602 -5 Left 982831595 4:160068003-160068025 CCTCACCGCCATGGGGGCCTCAG No data
Right 982831602 4:160068021-160068043 CTCAGGGCTCCAACTGATCAGGG No data
982831595_982831604 20 Left 982831595 4:160068003-160068025 CCTCACCGCCATGGGGGCCTCAG No data
Right 982831604 4:160068046-160068068 GAAAGTGCTGATCTTTTTAAAGG No data
982831595_982831605 25 Left 982831595 4:160068003-160068025 CCTCACCGCCATGGGGGCCTCAG No data
Right 982831605 4:160068051-160068073 TGCTGATCTTTTTAAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831595 Original CRISPR CTGAGGCCCCCATGGCGGTG AGG (reversed) Intergenic