ID: 982831596

View in Genome Browser
Species Human (GRCh38)
Location 4:160068004-160068026
Sequence CTCACCGCCATGGGGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831590_982831596 -9 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831596 4:160068004-160068026 CTCACCGCCATGGGGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831596 Original CRISPR CTCACCGCCATGGGGGCCTC AGG Intergenic