ID: 982831597

View in Genome Browser
Species Human (GRCh38)
Location 4:160068005-160068027
Sequence TCACCGCCATGGGGGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831590_982831597 -8 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831597 4:160068005-160068027 TCACCGCCATGGGGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831597 Original CRISPR TCACCGCCATGGGGGCCTCA GGG Intergenic