ID: 982831598

View in Genome Browser
Species Human (GRCh38)
Location 4:160068008-160068030
Sequence GAGCCCTGAGGCCCCCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831598_982831602 -10 Left 982831598 4:160068008-160068030 CCGCCATGGGGGCCTCAGGGCTC No data
Right 982831602 4:160068021-160068043 CTCAGGGCTCCAACTGATCAGGG No data
982831598_982831604 15 Left 982831598 4:160068008-160068030 CCGCCATGGGGGCCTCAGGGCTC No data
Right 982831604 4:160068046-160068068 GAAAGTGCTGATCTTTTTAAAGG No data
982831598_982831605 20 Left 982831598 4:160068008-160068030 CCGCCATGGGGGCCTCAGGGCTC No data
Right 982831605 4:160068051-160068073 TGCTGATCTTTTTAAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831598 Original CRISPR GAGCCCTGAGGCCCCCATGG CGG (reversed) Intergenic