ID: 982831601

View in Genome Browser
Species Human (GRCh38)
Location 4:160068020-160068042
Sequence CCTCAGGGCTCCAACTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831595_982831601 -6 Left 982831595 4:160068003-160068025 CCTCACCGCCATGGGGGCCTCAG No data
Right 982831601 4:160068020-160068042 CCTCAGGGCTCCAACTGATCAGG No data
982831590_982831601 7 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831601 4:160068020-160068042 CCTCAGGGCTCCAACTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831601 Original CRISPR CCTCAGGGCTCCAACTGATC AGG Intergenic