ID: 982831602

View in Genome Browser
Species Human (GRCh38)
Location 4:160068021-160068043
Sequence CTCAGGGCTCCAACTGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982831598_982831602 -10 Left 982831598 4:160068008-160068030 CCGCCATGGGGGCCTCAGGGCTC No data
Right 982831602 4:160068021-160068043 CTCAGGGCTCCAACTGATCAGGG No data
982831590_982831602 8 Left 982831590 4:160067990-160068012 CCAGTTTAGGCTTCCTCACCGCC No data
Right 982831602 4:160068021-160068043 CTCAGGGCTCCAACTGATCAGGG No data
982831595_982831602 -5 Left 982831595 4:160068003-160068025 CCTCACCGCCATGGGGGCCTCAG No data
Right 982831602 4:160068021-160068043 CTCAGGGCTCCAACTGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982831602 Original CRISPR CTCAGGGCTCCAACTGATCA GGG Intergenic