ID: 982856616

View in Genome Browser
Species Human (GRCh38)
Location 4:160390411-160390433
Sequence GGCCATCGGGTTGCCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982856612_982856616 0 Left 982856612 4:160390388-160390410 CCATCTCTTATTGATAATCTATT No data
Right 982856616 4:160390411-160390433 GGCCATCGGGTTGCCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982856616 Original CRISPR GGCCATCGGGTTGCCAGTGA TGG Intergenic
No off target data available for this crispr