ID: 982857369

View in Genome Browser
Species Human (GRCh38)
Location 4:160401094-160401116
Sequence TCAAATGTATTTTCACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982857369_982857371 12 Left 982857369 4:160401094-160401116 CCATTATGTGAAAATACATTTGA No data
Right 982857371 4:160401129-160401151 TGTATTTAATTTTCTAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982857369 Original CRISPR TCAAATGTATTTTCACATAA TGG (reversed) Intergenic
No off target data available for this crispr