ID: 982861634

View in Genome Browser
Species Human (GRCh38)
Location 4:160458587-160458609
Sequence CCCCATACACTGAAGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982861628_982861634 8 Left 982861628 4:160458556-160458578 CCTGATCTTTCAAAATGGTTATT No data
Right 982861634 4:160458587-160458609 CCCCATACACTGAAGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982861634 Original CRISPR CCCCATACACTGAAGCAAGA GGG Intergenic
No off target data available for this crispr