ID: 982867696 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:160538154-160538176 |
| Sequence | GTCAAGGTAGAAAAGTCAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982867696_982867703 | 16 | Left | 982867696 | 4:160538154-160538176 | CCCTCTGACTTTTCTACCTTGAC | No data | ||
| Right | 982867703 | 4:160538193-160538215 | TAATTATCTCTTGGATCCTAAGG | No data | ||||
| 982867696_982867701 | 7 | Left | 982867696 | 4:160538154-160538176 | CCCTCTGACTTTTCTACCTTGAC | No data | ||
| Right | 982867701 | 4:160538184-160538206 | AAATGTCCATAATTATCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982867696 | Original CRISPR | GTCAAGGTAGAAAAGTCAGA GGG (reversed) | Intergenic | ||