ID: 982867696

View in Genome Browser
Species Human (GRCh38)
Location 4:160538154-160538176
Sequence GTCAAGGTAGAAAAGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982867696_982867703 16 Left 982867696 4:160538154-160538176 CCCTCTGACTTTTCTACCTTGAC No data
Right 982867703 4:160538193-160538215 TAATTATCTCTTGGATCCTAAGG No data
982867696_982867701 7 Left 982867696 4:160538154-160538176 CCCTCTGACTTTTCTACCTTGAC No data
Right 982867701 4:160538184-160538206 AAATGTCCATAATTATCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982867696 Original CRISPR GTCAAGGTAGAAAAGTCAGA GGG (reversed) Intergenic