ID: 982887672

View in Genome Browser
Species Human (GRCh38)
Location 4:160802469-160802491
Sequence TTGGAGACTCAGAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982887666_982887672 7 Left 982887666 4:160802439-160802461 CCAAAGGCATACACAGTGGTAGA No data
Right 982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG No data
982887665_982887672 8 Left 982887665 4:160802438-160802460 CCCAAAGGCATACACAGTGGTAG No data
Right 982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982887672 Original CRISPR TTGGAGACTCAGAATGGGGA TGG Intergenic
No off target data available for this crispr