ID: 982894378

View in Genome Browser
Species Human (GRCh38)
Location 4:160899316-160899338
Sequence CCAAATGTTGATACTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982894372_982894378 22 Left 982894372 4:160899271-160899293 CCTCAAGCATTCATTGTATGATG No data
Right 982894378 4:160899316-160899338 CCAAATGTTGATACTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982894378 Original CRISPR CCAAATGTTGATACTGGTAT TGG Intergenic
No off target data available for this crispr