ID: 982905047

View in Genome Browser
Species Human (GRCh38)
Location 4:161057395-161057417
Sequence TTGAAGTAGGATGAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982905047_982905053 30 Left 982905047 4:161057395-161057417 CCATCCTTCTCATCCTACTTCAA No data
Right 982905053 4:161057448-161057470 CATAACTATTGTTGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982905047 Original CRISPR TTGAAGTAGGATGAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr