ID: 982907338

View in Genome Browser
Species Human (GRCh38)
Location 4:161091189-161091211
Sequence CTGTTCTGATGGAAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982907338_982907343 14 Left 982907338 4:161091189-161091211 CCCTGACTCTTCCATCAGAACAG No data
Right 982907343 4:161091226-161091248 GCTTTGTGTGTATATGCAGCGGG No data
982907338_982907342 13 Left 982907338 4:161091189-161091211 CCCTGACTCTTCCATCAGAACAG No data
Right 982907342 4:161091225-161091247 AGCTTTGTGTGTATATGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982907338 Original CRISPR CTGTTCTGATGGAAGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr