ID: 982910400

View in Genome Browser
Species Human (GRCh38)
Location 4:161134530-161134552
Sequence GAGCCATATGGAAAGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982910398_982910400 2 Left 982910398 4:161134505-161134527 CCTAGAAAGCATCTTCTCTTAAT No data
Right 982910400 4:161134530-161134552 GAGCCATATGGAAAGCTGACAGG No data
982910397_982910400 5 Left 982910397 4:161134502-161134524 CCACCTAGAAAGCATCTTCTCTT No data
Right 982910400 4:161134530-161134552 GAGCCATATGGAAAGCTGACAGG No data
982910396_982910400 12 Left 982910396 4:161134495-161134517 CCTTAGTCCACCTAGAAAGCATC No data
Right 982910400 4:161134530-161134552 GAGCCATATGGAAAGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982910400 Original CRISPR GAGCCATATGGAAAGCTGAC AGG Intergenic
No off target data available for this crispr