ID: 982925961

View in Genome Browser
Species Human (GRCh38)
Location 4:161337355-161337377
Sequence GACCTACTTCCTGTTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982925961_982925962 -4 Left 982925961 4:161337355-161337377 CCAGGACAAACAGGAAGTAGGTC No data
Right 982925962 4:161337374-161337396 GGTCTGTCATTTAGTTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982925961 Original CRISPR GACCTACTTCCTGTTTGTCC TGG (reversed) Intergenic
No off target data available for this crispr