ID: 982928754

View in Genome Browser
Species Human (GRCh38)
Location 4:161375042-161375064
Sequence ATGGAAATGAATAAGCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982928752_982928754 5 Left 982928752 4:161375014-161375036 CCTATAACATGTTAAGTGTCTAT No data
Right 982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982928754 Original CRISPR ATGGAAATGAATAAGCAGCA CGG Intergenic
No off target data available for this crispr