ID: 982930959

View in Genome Browser
Species Human (GRCh38)
Location 4:161407371-161407393
Sequence GAGAGAAAACTGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 696}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982930956_982930959 30 Left 982930956 4:161407318-161407340 CCACAAAAACAGAGATTTCTACT 0: 1
1: 0
2: 1
3: 37
4: 335
Right 982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG 0: 1
1: 0
2: 5
3: 77
4: 696
982930957_982930959 4 Left 982930957 4:161407344-161407366 CCAACATAATTTGAACAGATCTT 0: 8
1: 22
2: 26
3: 54
4: 283
Right 982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG 0: 1
1: 0
2: 5
3: 77
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982930959 Original CRISPR GAGAGAAAACTGAATGAGGA TGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
902098976 1:13969394-13969416 GGGAGAAAACCAAATGAAGATGG + Intergenic
902797963 1:18811644-18811666 GGGAGAAAGATGAAGGAGGAAGG - Intergenic
903420217 1:23213575-23213597 GAGAGAATACAGAATGTGTAGGG - Intergenic
903982215 1:27197368-27197390 GAGAGGAAACGGCAGGAGGAAGG - Intergenic
905043573 1:34978958-34978980 GAGATAAAAATGTATTAGGAAGG + Intergenic
906265331 1:44424638-44424660 GACAGGAGACTGGATGAGGAAGG - Intronic
906280134 1:44547450-44547472 GAGAGAAAAGTGTTTCAGGAGGG - Intronic
906337742 1:44948789-44948811 GAGAGAAGACTGAATTAGGTAGG - Intronic
906679387 1:47715066-47715088 GAGAGGAAACCCAATGAGGGTGG + Intergenic
907342622 1:53747793-53747815 GAGAAAACACAGGATGAGGAGGG - Intergenic
907507824 1:54934369-54934391 GGGAGATAACTGAATCATGAGGG - Intergenic
909738850 1:79002607-79002629 TAGAATAAACTGAATTAGGAAGG + Intronic
910146923 1:84091027-84091049 AAGAGAAAACTGAAAGTGAAGGG - Intronic
910387393 1:86700288-86700310 GAGAAAGGATTGAATGAGGATGG + Intergenic
911100710 1:94093950-94093972 GAAACAAAACTAAATCAGGAAGG - Intronic
911215240 1:95185930-95185952 GAGACAAAAGTGAATGAGGAAGG + Intronic
911333145 1:96549040-96549062 GAAAAAAAAATGAATCAGGATGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911864662 1:103002566-103002588 GAGGGAAAACTGTTTGAGGGTGG - Intronic
911878553 1:103202149-103202171 GAAATAAAACTGAATAAAGAAGG - Intergenic
912582894 1:110736135-110736157 GGGAAAAAAATGAATGAGTAAGG - Intergenic
912744000 1:112229834-112229856 GAGAGAAATTTGAATGAGGAGGG + Intergenic
913023455 1:114810305-114810327 GTGAGAAAACTGCATGAGGCTGG + Intergenic
913508794 1:119543787-119543809 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913511903 1:119569755-119569777 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913516136 1:119607069-119607091 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913528634 1:119716522-119716544 GAGAGAACATTGAAGAAGGATGG + Intronic
915024449 1:152814215-152814237 GAGAGATAAATGGATAAGGATGG - Intergenic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
915939345 1:160108935-160108957 GAGAGAAAAGACAATGAGGGTGG + Intergenic
916312307 1:163410721-163410743 GAGAGCAGACTGAATGAGGGAGG - Intergenic
916809954 1:168296555-168296577 GGGAGATAACTGAATCATGAGGG - Intronic
917474497 1:175356767-175356789 GAGAGAGAACTTGATTAGGAAGG - Intronic
917680260 1:177358780-177358802 GAGAGAAAGATAAATGAGGAAGG + Intergenic
918059869 1:181051782-181051804 GAGCCAAAACTGAGTGGGGATGG + Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918851712 1:189699285-189699307 GAGAGAAAAATGAAGAAAGATGG - Intergenic
919153175 1:193725757-193725779 GAGAAAACAGTGAATGATGATGG + Intergenic
919274911 1:195401397-195401419 GAGAGAAGAAGGAAAGAGGAAGG + Intergenic
919372065 1:196740099-196740121 GGGAGAAAATTGAATCATGAGGG - Intronic
919429384 1:197473921-197473943 TAGAGTGAACTGAATGAGTAGGG - Intronic
919546325 1:198924113-198924135 GCGAGGAAACTGAATAAGAAAGG + Intergenic
919698419 1:200605179-200605201 GGGTGAAAACTGAATGAGATCGG + Intronic
919698437 1:200605303-200605325 GGGTGAAAACTGAATGAGATCGG + Exonic
919956658 1:202424028-202424050 GAGATAAAACTGATTGAGGCTGG - Intronic
920078695 1:203356021-203356043 GAGAGATACCTGAATAAGGAAGG + Intergenic
920196904 1:204234111-204234133 GAGATAATCCTGGATGAGGATGG + Intronic
920352746 1:205348445-205348467 GAAAGAAAACTGCATAAAGAAGG - Exonic
920517109 1:206593381-206593403 GAGAAAACACTGAATTTGGAAGG + Intronic
920941331 1:210485789-210485811 GGGAGAAAATTGAATCATGAGGG - Intronic
921079462 1:211726974-211726996 TAGAGAAGAATGAATGTGGAGGG + Intergenic
921487319 1:215730446-215730468 GAGAGAGAGCTGAAAGAGGAGGG - Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922128747 1:222755761-222755783 GAGAGAAAAATGAGTTAAGATGG - Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
923515073 1:234690282-234690304 GAGAGAAAAGAGAATAATGATGG + Intergenic
923892018 1:238226614-238226636 GGGAGAAAACTGAATCATGGGGG - Intergenic
923909558 1:238426076-238426098 GGGAGAAGAATCAATGAGGAAGG - Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924659525 1:246003539-246003561 GAGATAAAAAGGAATGGGGAGGG - Intronic
1062988674 10:1794835-1794857 GACAGAAAACATAGTGAGGAAGG + Intergenic
1063373260 10:5535690-5535712 GAAAGAAAAGAGAATGTGGAAGG - Intergenic
1063485275 10:6414447-6414469 AACAGAAAAATAAATGAGGAGGG + Intergenic
1063497582 10:6524736-6524758 GGGAGAAAAGTGGGTGAGGAGGG + Intronic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1064979908 10:21155746-21155768 GAGAGAAAACTGACTGGGCAAGG + Intronic
1065163926 10:22954732-22954754 TAGAGAAAACAAATTGAGGAGGG - Intronic
1065223174 10:23516771-23516793 GAGAGAAAATTGAATGAAGCTGG - Intergenic
1065424189 10:25582082-25582104 GGGAGATAACTGAATCATGAGGG - Intronic
1066286459 10:33971205-33971227 GAGAGAAAACCAAAGGAGCATGG - Intergenic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067975137 10:51016214-51016236 GACTGAAAAATGAAAGAGGAGGG - Intronic
1069031668 10:63602768-63602790 AAGATAAAAATAAATGAGGAAGG - Intronic
1069361436 10:67647084-67647106 TCGTGAAAACTGAATGAGGCAGG - Intronic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1070339726 10:75486711-75486733 GAGAGAAAGCCCAAGGAGGAGGG - Intronic
1070339964 10:75488899-75488921 GAAAGAAAACTGTATGCTGAGGG - Intronic
1070873332 10:79777903-79777925 GATAGGAAATTGAAAGAGGAGGG - Intergenic
1070907945 10:80091050-80091072 GAGAAAAAACTGACTAACGAGGG - Exonic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071640260 10:87300054-87300076 GATAGGAAATTGAAAGAGGAGGG - Intergenic
1071654971 10:87437892-87437914 GATAGGAAATTGAAAGAGGAGGG + Intergenic
1071998207 10:91167624-91167646 GAGAGAATGCTGCATGGGGAGGG + Intronic
1073059260 10:100723797-100723819 GAGAGAAAACTGAGGGGGAAGGG + Intergenic
1073383227 10:103097964-103097986 GAAAGAACACTGAATGGGGAGGG - Intronic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1074264991 10:111893086-111893108 GGGAGATAACTGAATCATGAGGG - Intergenic
1074278991 10:112033293-112033315 GGGAGGAAACTGAATAATGAGGG - Intergenic
1074286395 10:112101882-112101904 GAGAGGTAACTGAATCATGAGGG - Intergenic
1074488897 10:113920186-113920208 GATAGGAAACTGAATGTCGATGG - Intergenic
1074527155 10:114272693-114272715 GAAAGAAAAGTGAATGATGTGGG - Intronic
1074640689 10:115377219-115377241 GGGAGATAACTGAATCACGACGG + Intronic
1075141914 10:119845365-119845387 AAAACAAAAATGAATGAGGAAGG + Intronic
1075786058 10:125050934-125050956 GGGAGACATCTGGATGAGGAGGG + Intronic
1075976187 10:126697461-126697483 GGGAGAAAATTGAATAATGAGGG + Intergenic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076623118 10:131805769-131805791 GTGAGAAAACTAAATTAGGGTGG - Intergenic
1077900107 11:6481067-6481089 GAGACATAACTGACTGTGGAAGG - Intronic
1077999008 11:7478186-7478208 GAGAGGGCACTGAATGAAGAAGG - Intergenic
1078028592 11:7724549-7724571 CCCAGAAAACTGCATGAGGAGGG + Intergenic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078764574 11:14282142-14282164 CAGAGAAAACTGAATGTGTGAGG + Intronic
1078927524 11:15887978-15888000 TAGAGCATGCTGAATGAGGAAGG - Intergenic
1079330256 11:19527155-19527177 GGGAGATAACTGAATCATGAGGG + Intronic
1079538656 11:21545701-21545723 GAGTGAAAACAGAATGAGAGGGG + Intronic
1079594269 11:22222849-22222871 GGGAGAAAACAGAATATGGAAGG - Intronic
1079844681 11:25450545-25450567 AAAATAAAAGTGAATGAGGAAGG - Intergenic
1080042409 11:27772719-27772741 CAGAGAAGACTGACTGTGGAGGG + Intergenic
1080264759 11:30389010-30389032 GAGAGAAAACTGAATAATTTAGG - Intronic
1080313480 11:30921991-30922013 GAGAGAAGGCTGAATCAGGGAGG + Intronic
1080656776 11:34264581-34264603 GGGAGAAAACTGAAAGAAAAAGG - Intronic
1081222419 11:40477894-40477916 GAGAGATAACTGAATCATGGGGG + Intronic
1081529041 11:43945335-43945357 GAGAGAGAAGAGAATGAGGCTGG - Intergenic
1082271903 11:50181322-50181344 TAGAGAAAACTGAAGGAGAAGGG - Intergenic
1082950078 11:58805326-58805348 GAGGTAAAACTGCATGAGGAGGG - Intergenic
1083118035 11:60483102-60483124 CAAAGAAAATTGAATGAGCAGGG - Intergenic
1083143146 11:60738154-60738176 GAGAGAAAGGTGAAAGAGAAAGG - Intronic
1083529374 11:63404964-63404986 GAGAGAATAATGAATTGGGAGGG + Intronic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1085069528 11:73530593-73530615 GAGGGAAAAGTGAAAAAGGAAGG - Intronic
1085359625 11:75875534-75875556 GAGAGAAAATGGATTAAGGAAGG - Intronic
1085584309 11:77687067-77687089 TTTAGAAAACTGAATGACGATGG + Intronic
1085874503 11:80389573-80389595 GATACAAAACTGAATGAGGCAGG - Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086532949 11:87807680-87807702 GAGGGAAAAATGAATGAGAATGG + Intergenic
1086620773 11:88884678-88884700 GGGAGGTAACTGAATGATGAGGG + Intronic
1086743421 11:90396123-90396145 GGAATAAAACTGAATAAGGAAGG + Intergenic
1087439119 11:98160535-98160557 GAGAGATAACTGAGTGAGATGGG - Intergenic
1087511470 11:99101205-99101227 GAGAGATAACTGAATCATGGGGG - Intronic
1087580454 11:100045006-100045028 GAGAGAAAACTGCATTTTGATGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087767992 11:102177151-102177173 GAGAGAAGATTGAATGAGGAGGG + Intronic
1087792367 11:102420140-102420162 GAGAGCAGGCTGGATGAGGATGG - Intronic
1088107172 11:106220408-106220430 GAGATATAACAGAATAAGGAAGG + Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088191022 11:107228343-107228365 GAGAGAAAACTCATAGTGGATGG - Intergenic
1088900649 11:114114310-114114332 GAGGGAAACCTGACTGGGGAGGG + Intronic
1089060829 11:115624763-115624785 GAAAGAAAACTGAATGAAAGAGG + Intergenic
1089495442 11:118906370-118906392 GAGAGAGAACTGATACAGGATGG + Intronic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090073486 11:123563910-123563932 TAGAGAAAACTGTAAGAGGTCGG - Intronic
1090429107 11:126631082-126631104 CACAGACAACTGAATGAAGAGGG - Intronic
1090644941 11:128759896-128759918 GAGAGAGAAGGGAATGAGCATGG + Intronic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090819996 11:130333280-130333302 TAGATAAAACTGAATGAGGCTGG - Intergenic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092076940 12:5681682-5681704 GATATGAAACTGAATAAGGAAGG - Intronic
1092143233 12:6198399-6198421 GAGAGAAGAATGAATGAAGGCGG - Intergenic
1093233098 12:16573239-16573261 GAGAGAATATTGAATAAGGCAGG + Intronic
1093950539 12:25161112-25161134 GAGAGACGACTGAAAGAGGAAGG - Exonic
1095457814 12:42407872-42407894 GGGAGAAAAATGAATGGGTATGG - Intronic
1096360878 12:50985311-50985333 GAGAGAGCACTAAATGAGGAAGG + Intronic
1097370144 12:58768493-58768515 CTAAGAAAACTGAGTGAGGAAGG + Intronic
1097914787 12:65009339-65009361 GAGATAATATTGAATGAGGATGG - Intergenic
1098129218 12:67331294-67331316 GAAAGAAAAGTGAAAGAGAAAGG - Intergenic
1099466877 12:82999730-82999752 GAGAGATAACTGAATCATGCTGG - Intronic
1099478538 12:83139018-83139040 GATAGAAATCTGAATGAATAGGG + Intergenic
1100123545 12:91396117-91396139 GAGAGAAGAATGAAGAAGGAAGG - Intergenic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1100888919 12:99102332-99102354 TTGAGAAATCTGAATGAGTAAGG + Intronic
1101079367 12:101166914-101166936 GAGAGAAAAAGGAGTGAGAAAGG + Intronic
1101196409 12:102387457-102387479 GAGAGAATACTAAAAGAGAAGGG + Intergenic
1101198242 12:102407747-102407769 GACAGAAGACTCAATGAGGAGGG + Intronic
1101337291 12:103807757-103807779 GGGAGACAACTGAATGATGGGGG + Intronic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1101594800 12:106154716-106154738 GAGAGAAGAAAGATTGAGGATGG + Intergenic
1101667918 12:106836981-106837003 GAGAGTAATGTGACTGAGGAAGG - Intronic
1101879779 12:108618353-108618375 GAGAGAAAACTGTAAAGGGAAGG + Intergenic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102590009 12:113949870-113949892 GAGAGTAAACTGACTTAGGAGGG - Intronic
1102748603 12:115272158-115272180 GAAAGAAAAGAGAAAGAGGAAGG + Intergenic
1102785132 12:115598768-115598790 GAGAGAAGAGTAAATGAAGATGG - Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103186072 12:118958633-118958655 GAGAGAAAATGGGATGGGGATGG - Intergenic
1103828294 12:123757976-123757998 GAAAGTAGACTGAATGAGAAAGG - Exonic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104668887 12:130667100-130667122 GAGAAAAAAAGGAATGAGGGAGG + Intronic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1105960964 13:25338828-25338850 GAGTAAAAACTGAATCAGGGAGG - Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1107130869 13:36894243-36894265 GAGAGATAATTGAATCATGAGGG + Intronic
1107323962 13:39220255-39220277 GGGAGATAACTGAATCATGAGGG - Intergenic
1107998390 13:45884142-45884164 GGGAGAACACTGCATGAAGATGG - Intergenic
1108786873 13:53914287-53914309 AACAAAAAACTGAAAGAGGAAGG + Intergenic
1109305821 13:60640480-60640502 CAGAGACAACTGAATGAAGCTGG - Intergenic
1110572000 13:77014527-77014549 GGGAGAAAAGAGAATGAGCAAGG + Intronic
1110621229 13:77598226-77598248 GAGAGAAAAATGAATAATCAAGG + Intronic
1111145995 13:84180976-84180998 AAGACAAGAATGAATGAGGAAGG + Intergenic
1111224975 13:85258085-85258107 GAGATAAACCTGAAAGATGATGG + Intergenic
1111343338 13:86916334-86916356 CAGAGAAGACTGAAAGAGTAGGG + Intergenic
1111751489 13:92337013-92337035 GGGAGATAACTGAATCATGAGGG - Intronic
1111777396 13:92681668-92681690 GAGAGAAATGAGAATTAGGAGGG - Intronic
1113015334 13:105822654-105822676 GAGAAAATAATGAAGGAGGAAGG - Intergenic
1113912656 13:113851144-113851166 GATGGATAAATGAATGAGGATGG + Intronic
1114524964 14:23361863-23361885 GAAAGAAAACTGGAAGAGGGAGG + Intronic
1114843576 14:26294275-26294297 GAGAGAAAACTGTAAGAGAGTGG - Intergenic
1114879714 14:26769023-26769045 GTAAGAAGACTTAATGAGGAGGG + Intergenic
1115027379 14:28760518-28760540 GAGAGAAAACTTCATGAGTGGGG - Intergenic
1115091100 14:29576765-29576787 GGGAAAAAAATGAATGAGGAGGG - Exonic
1115408644 14:33047821-33047843 CTGAGAAAACTGACTCAGGAAGG - Intronic
1115500135 14:34042334-34042356 GACACAAAATTGAATGAGTAAGG + Intronic
1116183181 14:41561672-41561694 GAGACTAAAGTGAAAGAGGATGG - Intergenic
1116267504 14:42712599-42712621 GAGAGATAACTGAATCATGGGGG - Intergenic
1116492794 14:45526426-45526448 GAGATAACACTGAATGTGGATGG + Intergenic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1116666682 14:47785330-47785352 CGTAGAAAACAGAATGAGGAGGG - Intergenic
1117165823 14:53032128-53032150 GACATAAAACTGGATTAGGATGG - Intergenic
1117825874 14:59703054-59703076 GAGAGAGAACTCATTGAAGAAGG - Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118459946 14:65978489-65978511 GGGAGATAACTGAATCATGAGGG + Intronic
1119712578 14:76833209-76833231 GAGAGAGTGATGAATGAGGAAGG + Intronic
1120355006 14:83421379-83421401 GAGAGAAAGCTGAGTGGTGAAGG - Intergenic
1120583346 14:86280632-86280654 GAGAGATAACTGAATCATGAGGG + Intergenic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1120829702 14:88987061-88987083 GGGAGAGAACTGAATCATGAGGG - Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121542923 14:94741977-94741999 GAGAGGAAAATGAAGGAGAAAGG - Intergenic
1122020860 14:98836814-98836836 AAGAGAGAACGGATTGAGGATGG - Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1124698018 15:31882740-31882762 AAGAGGAAACTGAGTGAGGTTGG + Intergenic
1124972576 15:34503218-34503240 GAGAGAAATGAGAATTAGGAGGG - Intergenic
1125872597 15:43115587-43115609 GAGAGAAAATAGAAAGGGGAAGG + Intronic
1126631247 15:50738250-50738272 GAACAAAAACTGAATGAGGCTGG + Intronic
1126646617 15:50881399-50881421 GAGAGAAAACTGTGTGGAGAAGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1130044909 15:80436049-80436071 GGGGGAAAGCTGAATAAGGAGGG - Intronic
1130075348 15:80684169-80684191 GAGAGATAACTGAATCATGGGGG + Intronic
1131337665 15:91565240-91565262 GAGAGAAAACTGTAATGGGATGG - Intergenic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134206398 16:12241824-12241846 GAGAGAAAACAGTCTGATGATGG - Intronic
1134249635 16:12565445-12565467 GAGAGAACCCAGGATGAGGAGGG - Intronic
1135381847 16:22002333-22002355 AAGAGAAAACCTAATGAGGTAGG + Intergenic
1135739032 16:24957563-24957585 GAGACAAAAATGAATAAGGAAGG + Intronic
1135979080 16:27132618-27132640 GGGAGGAAATTGAATGATGAGGG + Intergenic
1136617057 16:31404616-31404638 GGGAAAAAAATGAATGAGGCAGG + Intronic
1136706187 16:32189828-32189850 GAGAGAAGACTGAAAGACTATGG + Intergenic
1136761723 16:32739577-32739599 GAGAGAAGACTGAAAGACTATGG - Intergenic
1136806377 16:33130812-33130834 GAGAGAAGACTGAAAGACTATGG + Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1138328208 16:56192293-56192315 GAGAAAAACCTCAAAGAGGATGG + Exonic
1138349798 16:56340435-56340457 TAGAGAAATCTGCATGAGCAGGG + Intronic
1138836034 16:60435727-60435749 GTTATAAAACTGAATAAGGAAGG + Intergenic
1138978284 16:62235800-62235822 TAGAGAAAACTGAATGAAAAAGG - Intergenic
1139038570 16:62977149-62977171 AAGAAAAAAATGAATGAGGAGGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139294550 16:65888845-65888867 GAGAGAACAGGGAGTGAGGATGG + Intergenic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1140225002 16:73069985-73070007 GAAAGCAAACTGAATGAAGCAGG - Intergenic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1141767768 16:86070134-86070156 GAGAGGAAGCTGCATGAGGGCGG + Intergenic
1141792990 16:86249238-86249260 GGGAGATAATTGAATCAGGAGGG + Intergenic
1141874354 16:86812369-86812391 CTGAGAAAACTAAATCAGGATGG + Intergenic
1203063880 16_KI270728v1_random:999891-999913 GAGAGAAGACTGAAAGACTATGG - Intergenic
1143897111 17:10144984-10145006 GACAGGCAACTGGATGAGGAAGG + Intronic
1145239809 17:21234055-21234077 CGGAGAATACTGGATGAGGAGGG - Intergenic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1146110484 17:30084690-30084712 GAGAGAAATGTGAATCTGGAGGG - Intronic
1146442754 17:32911330-32911352 GAGAGAACACAGAAAGAGGTGGG + Intergenic
1146678978 17:34793438-34793460 GGGAGGAATCTCAATGAGGAAGG + Intergenic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147035748 17:37679123-37679145 CAGAGAAACGTGAAAGAGGAGGG - Intergenic
1147850326 17:43437381-43437403 GAAATAAAACTGAAAGAGGCTGG - Intergenic
1148391478 17:47276041-47276063 AAGAGAGAGCTGAATGGGGAGGG + Intronic
1148900450 17:50872017-50872039 GGAAGAAAAGGGAATGAGGATGG - Intergenic
1149087347 17:52733867-52733889 GAGTCAAGACTGAAAGAGGAAGG - Intergenic
1149371117 17:55994214-55994236 GGGAGATAACTGAATCATGAGGG - Intergenic
1149402872 17:56316685-56316707 GAGAGAAAAATAAATGAGGGTGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150934273 17:69618237-69618259 GAAAGAAAACTGAAGGAGAGAGG + Intergenic
1151221985 17:72619791-72619813 GAGAGAACACTGGAGGAGCAGGG - Intergenic
1151847033 17:76663817-76663839 GGGAGAACACTAAAGGAGGAAGG + Intergenic
1152409423 17:80115254-80115276 GAAAGAAAACACAACGAGGAAGG - Intergenic
1152909471 17:82991322-82991344 GGGAGATAACTGAATCATGAGGG + Intronic
1153691664 18:7600640-7600662 GAGAGACTGCTGAATGAGCAAGG - Intronic
1153836122 18:8965584-8965606 CAGAGAAAACTGCATGGCGAGGG - Intergenic
1153884631 18:9452818-9452840 GGGAGAGAAATGAAAGAGGATGG + Intergenic
1154519163 18:15208356-15208378 GAGAGAAAAAGAAAGGAGGAAGG - Intergenic
1155586864 18:27376323-27376345 GAAAGAAAAATGAATGAAGCAGG + Intergenic
1156198403 18:34802384-34802406 GAAAGACAAGTGCATGAGGATGG - Intronic
1156478602 18:37422105-37422127 GTGAGGAAACTGAATGTGGTGGG + Intronic
1156764565 18:40636263-40636285 GTGAGGAAACTGTAAGAGGAAGG - Intergenic
1156957130 18:42980685-42980707 AACAGAAAACCCAATGAGGAAGG + Intronic
1157075524 18:44462685-44462707 GAGAAAAAACTGCATCAGGAGGG - Intergenic
1157698883 18:49746857-49746879 GAGAGAAAACAGAATGAATGTGG - Intergenic
1157853154 18:51077193-51077215 GAGAGAAAACTAAGTGAGGGTGG + Intronic
1158500572 18:57997117-57997139 GAGAGATAAATGAATCATGAGGG - Intergenic
1158763821 18:60423037-60423059 GGGAGATAATTGAATCAGGAGGG - Intergenic
1159389688 18:67774278-67774300 GGGAGAGAGCTGAATGTGGAGGG - Intergenic
1159765087 18:72479770-72479792 GAGAGATAACTGAATCATGGGGG + Intergenic
1159915992 18:74188275-74188297 GAAAGAAAACTGAATGGGGCCGG - Intergenic
1160966119 19:1747666-1747688 GAGATAAAACTGAATGAAGCTGG - Intergenic
1162060162 19:8090031-8090053 GAGAGAAGAATGAGAGAGGAAGG + Intronic
1162363949 19:10236581-10236603 GAGAGAACAGTGGAGGAGGAAGG + Intergenic
1164486545 19:28660902-28660924 GGGAGAAAACTGAATCATGGGGG + Intergenic
1164681334 19:30135630-30135652 GAAAGAAGACGAAATGAGGACGG - Intergenic
1164797342 19:31044728-31044750 GAGGGAAAAATGAATGAAAATGG + Intergenic
1165376463 19:35446288-35446310 GAGAGAAAACTGAACTTGGAAGG + Intronic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1166012142 19:39950397-39950419 CAGAGAAACCTGAATGCGGGGGG - Intergenic
1166159578 19:40941724-40941746 GAGAGAAGACTGGCTGAGGAAGG + Intergenic
1166168519 19:41009655-41009677 GAGAGAAGACTGGCTGAGGAAGG + Intronic
1166521158 19:43481183-43481205 GTTAGAAAACTGAAGCAGGATGG + Intronic
1166573684 19:43816781-43816803 GAGAGATAACTGAATCATGGGGG + Intronic
1166745634 19:45140673-45140695 GAGAGGACACTGCAGGAGGAGGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167283356 19:48584431-48584453 GGAGGAACACTGAATGAGGATGG - Intronic
1167429134 19:49444224-49444246 GAAAGAAAAAGGAAGGAGGAAGG - Intergenic
1167429145 19:49444302-49444324 GAAAGAAAAAGGAAGGAGGAAGG - Intergenic
1167703934 19:51067324-51067346 GAATGAAAATTGGATGAGGATGG + Intergenic
1167791228 19:51683533-51683555 AAGAAAAAAATAAATGAGGATGG + Intergenic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
1168717997 19:58540236-58540258 GGGAGAATCCTGTATGAGGAGGG - Intergenic
1168718100 19:58540622-58540644 GGGAGAATCCTGTATGAGGAGGG - Intergenic
1168718240 19:58541204-58541226 GGGAGAATCCTGTATGAGGAGGG - Intergenic
1168718312 19:58541473-58541495 GAGAGAATCCTGTCTGAGGAGGG - Intergenic
925299597 2:2801149-2801171 GAGAGGTAACTGAATCATGAGGG + Intergenic
925960722 2:9012867-9012889 CATAGAAAACTGAATGATTAAGG - Intergenic
927003094 2:18819649-18819671 GAGAGGAAATTGAAAGAGAAAGG - Intergenic
927116218 2:19904687-19904709 GAGAAAAAACTGAATCATGGGGG - Intergenic
927438469 2:23090646-23090668 GAGAGAAAGAGGAAAGAGGAGGG + Intergenic
927800270 2:26092453-26092475 GAGAGGAAACTTAGTGAGGAAGG + Intronic
928077017 2:28274155-28274177 GAGAGAAAGCTGGATGGGGAAGG - Intronic
929241694 2:39660075-39660097 TAGAGAGTAGTGAATGAGGAAGG - Intergenic
929747785 2:44676754-44676776 GAGAGAGAACCTAATGAGCAAGG + Intronic
929814967 2:45223363-45223385 GAGAGCAAACTCAGAGAGGAAGG + Intergenic
930388998 2:50736537-50736559 GAGAGATAATTGAATCACGAGGG + Intronic
930907018 2:56582215-56582237 CAGAGGAAACTGAATTTGGATGG + Intergenic
931737963 2:65215142-65215164 AAGAGAAAGATGAATGAGGTAGG + Intergenic
932585897 2:73028586-73028608 GAGAGAAAACTCAGAAAGGAAGG + Intronic
932705783 2:74023949-74023971 TAGGAAAAACTGAATCAGGAGGG - Intronic
932711717 2:74070409-74070431 GAGAGATAACTGAATCATGGAGG - Intronic
934594696 2:95595101-95595123 CAGAGAAATCTATATGAGGAGGG + Exonic
936605727 2:113951034-113951056 GAGAGAGAATTGAATCATGAGGG - Intronic
936683279 2:114799334-114799356 AAGAGAAAACAGAATTAGTAGGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
939551671 2:143623576-143623598 AAGAGAATACTGAGTGAGAAAGG - Intronic
939789894 2:146559302-146559324 GGGACAAAACAGAATAAGGAAGG - Intergenic
939827050 2:147027543-147027565 GAGAGAAAACTACATGTGCATGG - Intergenic
939872805 2:147543566-147543588 GAGAGAGAACTGAAACAGAATGG - Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
942433301 2:175940410-175940432 GTGAGAAAACTATCTGAGGATGG + Intronic
942462718 2:176179373-176179395 GAGAGAAGGCTGAAGGAAGAGGG - Intergenic
942506250 2:176644534-176644556 GAGAGAATGCTGAATGAAGAAGG + Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942853548 2:180519724-180519746 GAGAGGCATATGAATGAGGATGG - Intergenic
943053828 2:182950150-182950172 GCTAGAAAAGTGAAGGAGGAAGG + Intronic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944155558 2:196603859-196603881 GAGAGAAAACTGAGAGTGGCCGG + Intergenic
944285193 2:197941737-197941759 GAGAGAAAGCAGAATGGTGAGGG - Intronic
944286210 2:197952713-197952735 GAGAGATAACTGAATTATGTTGG + Intronic
944713133 2:202353863-202353885 GAAAGAAAAATTAATGAGGTTGG - Intergenic
944761399 2:202818584-202818606 GAGAGATAACTGAATCATGGGGG + Intronic
944906931 2:204271027-204271049 GAAAGAAAACTGAGACAGGAAGG + Intergenic
945143811 2:206715313-206715335 GGGAGGAATCTCAATGAGGAAGG - Intronic
945177544 2:207058431-207058453 GAGAGAAAACAGATTGGGGTAGG - Intergenic
945336433 2:208598521-208598543 GAGAGATAACTGAATCATGAGGG - Intronic
945373347 2:209049020-209049042 GAGAAAAAACTGGAGGAGAATGG + Intergenic
946077834 2:217090103-217090125 GGCAGAAAACTGTATGAGTAAGG + Intergenic
946264277 2:218525127-218525149 AAAAGAAAACTGAACAAGGAAGG - Intronic
946285108 2:218697013-218697035 GAGATAAAAGTGAAAGAGGGCGG - Intronic
946760422 2:222988323-222988345 GGGAGATAACTGAATAAGGGGGG - Intergenic
947029972 2:225782697-225782719 GAGAGAGAAAGGAAGGAGGAAGG - Intergenic
947128997 2:226902421-226902443 GGGAGAAAACTGAACTGGGAAGG - Intronic
948060863 2:235042565-235042587 GACACAAAACTGGGTGAGGATGG - Exonic
948086362 2:235252819-235252841 GAGAGAAAAGGGAGAGAGGAAGG + Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948508416 2:238447032-238447054 GAGAGAATACTGAAGGGGCAAGG - Exonic
948935608 2:241162368-241162390 GAGAGTGAACTGACAGAGGAGGG + Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169275245 20:4229398-4229420 GAGAAAAAAATGAAGCAGGAAGG + Intronic
1169508769 20:6241936-6241958 GAGAGACAAATTAATGATGATGG + Intergenic
1170210744 20:13844156-13844178 GAACGGAAATTGAATGAGGATGG + Intergenic
1170400606 20:15979120-15979142 GAGAGGAAACTGTAAGATGAGGG + Intronic
1170525618 20:17233422-17233444 GAGTGACAACTGATTGAGTAAGG + Intronic
1171018379 20:21562071-21562093 GAGAGGAACCTGCCTGAGGATGG - Intergenic
1173072918 20:39786725-39786747 GAGAGATAACTGAATCATGGGGG - Intergenic
1173099747 20:40074720-40074742 GAGATAAAACAGATTAAGGAGGG - Intergenic
1173334679 20:42102738-42102760 GAGAGAAAGCTGTCTGAGTATGG + Intronic
1173772793 20:45678005-45678027 GAGAAAAAAAAGAATGAAGAAGG - Intergenic
1174454948 20:50642286-50642308 GGGAGAAAACTGAGAAAGGATGG - Intronic
1174471856 20:50767444-50767466 GGGAGAAAACTGAGAAAGGATGG + Intergenic
1174710733 20:52702297-52702319 GAGAGAGATATGTATGAGGAAGG + Intergenic
1175663909 20:60842159-60842181 GGGAGATAACTGAATCATGAGGG - Intergenic
1177258521 21:18697152-18697174 GAGAGCAAACTGAATGCAGTAGG + Intergenic
1177742296 21:25168640-25168662 GAGAGATAACTGAATCATGGGGG + Intergenic
1178145877 21:29739300-29739322 GAGAGGAAACGGAATAAGGGAGG + Intronic
1178226242 21:30722214-30722236 TAGAGAAATCTTCATGAGGATGG - Intergenic
1178295519 21:31406788-31406810 AGGTGAAAATTGAATGAGGAGGG - Intronic
1178365905 21:31988629-31988651 GAGAGAAAAATGAGGGAGGGAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179116696 21:38499813-38499835 GAGAGAGAAAGGAAGGAGGATGG + Intronic
1179161103 21:38900124-38900146 GGGAGATAACTGAATCATGAGGG + Intergenic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1181676954 22:24461226-24461248 AAGAGAAAAGTGAGTGATGATGG - Intergenic
1182173984 22:28264148-28264170 GAGAGGTAACTGAATCATGAGGG + Intronic
1182565481 22:31195436-31195458 GAGAGAAAAATGCATGTGGATGG - Intronic
1182656746 22:31896751-31896773 GAGAGAAATGTGATGGAGGAGGG - Intronic
1182822797 22:33233185-33233207 GAGAGAGAACAGAATGAGTGTGG + Intronic
1182889890 22:33808896-33808918 GAGAGAAGAATGGATGAAGATGG - Intronic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1183767927 22:39896541-39896563 TAGAGATAACTGAAAGAAGAGGG + Intergenic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
949261578 3:2107750-2107772 GAAAGAATACTGGATAAGGAAGG + Intronic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
950009315 3:9711665-9711687 GAGAGAAAACTAGGTCAGGAGGG - Intronic
950117027 3:10457704-10457726 GAGAGAACAGGGAAAGAGGAAGG + Intronic
950429391 3:12942104-12942126 GTGAGCAAAATCAATGAGGAAGG - Intronic
950896501 3:16456404-16456426 GAGAGGAAACTCAAGGAGAATGG + Intronic
951144475 3:19210773-19210795 GAGATAAAAATGAAGGATGATGG + Intronic
951187913 3:19735600-19735622 GAGACAAATGTGAATGAAGAGGG - Intergenic
951218264 3:20043888-20043910 GAGAGATTAGAGAATGAGGAGGG + Intronic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
952418351 3:33109501-33109523 GACAGAGACCTGAAAGAGGAGGG - Intergenic
952460666 3:33522188-33522210 AAGAGAAAAATGAAAAAGGAGGG - Intronic
952933489 3:38377424-38377446 AAAAGAAAAGTAAATGAGGAAGG - Intronic
953461749 3:43086937-43086959 GAGATCATACTGGATGAGGATGG + Intronic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
953811920 3:46120093-46120115 GAGAGAAGGCTGAAGGAGGAAGG + Intergenic
955278640 3:57572724-57572746 AAAAGAAAGCTGAATGAGGGGGG - Intronic
955609946 3:60746324-60746346 GAGAGATAATTGAAGGAGGTGGG + Intronic
955648215 3:61163668-61163690 GAGAAAAATCTGAATAAAGAAGG + Intronic
955844166 3:63143267-63143289 GAGATCATACTGAATTAGGATGG - Intergenic
955935217 3:64096497-64096519 CAGAGAATGCTGAATGAGGAAGG - Exonic
956486124 3:69723683-69723705 GAGAGAAAAAAGAATGAAAAAGG - Intergenic
957113429 3:75994406-75994428 GGGAGGTAACTGAATCAGGAGGG + Intronic
957803038 3:85110130-85110152 GAGAGAAAAGAGATTTAGGAAGG + Intronic
958031287 3:88114208-88114230 TAGAGAAAAATAAAGGAGGATGG + Intronic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958931873 3:100216051-100216073 GAGAGAAACCTGCTTAAGGAGGG - Intergenic
959313880 3:104777509-104777531 GACAGAAAAGTGAAGTAGGAAGG + Intergenic
959576561 3:107940609-107940631 GAGAGAATGCTGAATCATGATGG + Intergenic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960382170 3:116976756-116976778 GAAAGAAAAGTGACTGAGTATGG - Intronic
960416907 3:117396455-117396477 GAGAGGAGACTAAATGAGGATGG - Intergenic
960453021 3:117833548-117833570 GAGAAAATATTGATTGAGGATGG - Intergenic
960454939 3:117859576-117859598 GAGAGGTGACTGAAGGAGGAAGG - Intergenic
960864821 3:122188753-122188775 GAGAAAAAAGTGAATCAGGCTGG - Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961631815 3:128306785-128306807 ATGAGAAAACTGACTTAGGAAGG + Intronic
961971595 3:130974036-130974058 GAAAGAAGACTGAAGGAGGGTGG + Intronic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962272772 3:133990268-133990290 GACAAAAAACTGAAGAAGGAGGG - Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962931513 3:140041868-140041890 GAGACAAACCTGTGTGAGGAGGG + Intronic
963149822 3:142033831-142033853 GTGAGATAACTGAACCAGGAGGG + Intronic
963649282 3:147957717-147957739 GAGAGAAAAATGAGAGAGAAGGG + Intergenic
963781178 3:149487960-149487982 GAGAAATAACTAAAAGAGGACGG + Intronic
963796774 3:149638595-149638617 GAGAGAAAAAAGAAAGAGAATGG - Intronic
963821483 3:149899558-149899580 GAGAGAACACTGAAGGTGAAAGG + Intronic
964035310 3:152188525-152188547 GAGATTAAACTTAGTGAGGAAGG + Intergenic
964394240 3:156228813-156228835 GACAGAAAACTGTCTGTGGAAGG - Intronic
964488835 3:157213276-157213298 GAAAGAAAACAAAAAGAGGAGGG + Intergenic
964528600 3:157643164-157643186 GAGAGAAATCTGCTTGATGAGGG + Intronic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965530579 3:169766535-169766557 GAGAATAAATTGAATGAGGAAGG - Intergenic
965696765 3:171416509-171416531 TAGAGAAAGCTGAATATGGATGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966403346 3:179569227-179569249 GAGAGAAAGTTGTATGGGGAGGG - Intronic
966664060 3:182450770-182450792 GAGATAAAACACAGTGAGGAGGG - Intergenic
967505387 3:190247228-190247250 GAGAGATGACTGAATTATGAGGG - Intergenic
967553744 3:190830994-190831016 GAGAAAGAACGGAAAGAGGAAGG + Intergenic
967608744 3:191479882-191479904 AAGAGAGTACTAAATGAGGAAGG - Intergenic
967692090 3:192487171-192487193 GTAAGAAAAGTGAATGAGGTAGG - Intronic
968056247 3:195694139-195694161 CAGAGAAAAGGGAATGAGAACGG + Intergenic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
968713683 4:2138965-2138987 GAAGGAAAGCTGAATGAAGAGGG + Intronic
968820447 4:2846225-2846247 AAGAGAAAACTAAATATGGAGGG - Intronic
968826282 4:2900055-2900077 GAGAGAAAATTTTATGTGGAAGG + Intronic
969165882 4:5312014-5312036 GAGAGAAGAATGAAGAAGGATGG - Intronic
969321014 4:6412670-6412692 GGGAGAAGGCTGATTGAGGACGG + Intronic
969593006 4:8132566-8132588 GTCAGAAAACAGAATGCGGAAGG + Intronic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970465832 4:16321999-16322021 GGGAGATAACTGAATCATGAGGG - Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
970935727 4:21567747-21567769 AACTGAAAACTGGATGAGGATGG + Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971353433 4:25872872-25872894 GAGACACAACAGAATGAGCACGG - Intronic
971418893 4:26457629-26457651 GAGAGAAGAGTGAATGAGCTAGG - Intergenic
971461524 4:26903871-26903893 GAGAGATAATTGGATGAGAAAGG + Intronic
972063564 4:34910942-34910964 GAGAGAAAAATGAATCATGGGGG + Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
973151883 4:46898388-46898410 GAGAGACATTTGAATCAGGATGG - Intronic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973215328 4:47662137-47662159 GACAGAAGACAGAATGAGAAAGG - Intronic
973856403 4:55015016-55015038 AAGAGAATATTGAATGGGGAGGG - Intergenic
974143020 4:57911768-57911790 GAGAGAAAAATAAATAAGCATGG + Intergenic
974748012 4:66101720-66101742 GAGAGATAATTGAATCATGAGGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
974965884 4:68760270-68760292 GAGAAAATGCTGAATGTGGATGG - Intergenic
975000443 4:69219099-69219121 GAGAAAATACTGAGTGTGGATGG - Intergenic
975005325 4:69276104-69276126 GAGAAAATACTGAATGTGGATGG + Intergenic
975013744 4:69385094-69385116 GAGAAAATATTGAATGTGGATGG + Intronic
975015002 4:69404441-69404463 GAGAAAATACTGAATGTGGATGG + Intronic
975073767 4:70178443-70178465 GAGAGAAAAATGAGAGAGGTGGG - Intergenic
975495904 4:75035631-75035653 GAGATAAAAGGGAAGGAGGAGGG - Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976006948 4:80441001-80441023 GAGAGAAAAAAGAATGAAAAGGG + Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976841793 4:89440522-89440544 TAGAGAAATGTGAGTGAGGAAGG + Intergenic
976852331 4:89561693-89561715 GAGAGAATACAGTATGATGAGGG - Intergenic
977069798 4:92370698-92370720 GAGAGTAAGCTTAGTGAGGAAGG + Intronic
977487023 4:97661898-97661920 GAATTAAAACTGAATAAGGAGGG + Intronic
977773482 4:100888803-100888825 TAGAAATAACTGAATAAGGATGG - Intergenic
978831555 4:113091833-113091855 GAGCGCAAACTGAAAGAGGGTGG - Intronic
978844164 4:113252255-113252277 GGGAGATAACTGAATCAGGAGGG - Intronic
979108546 4:116719431-116719453 GATAGATAACTGAATCATGAGGG - Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979467757 4:121060138-121060160 AAGAGAAAACTGAAATAGTATGG - Intronic
979668926 4:123342102-123342124 GAGATAAATCTGTATAAGGAAGG - Intergenic
979867863 4:125778310-125778332 GGGAGAAACCTGCTTGAGGAGGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980731938 4:136835147-136835169 GAGAGAGAAATGCTTGAGGAAGG - Intergenic
980949310 4:139357098-139357120 GAAAGAAAACTGAAACAGGTAGG - Intronic
981510252 4:145548600-145548622 GATAGATAAGTGAATGGGGAAGG + Intronic
981655274 4:147105420-147105442 GAGAGAAAAATGAGAGAGGCTGG - Intergenic
981660664 4:147162849-147162871 GAGAGCAAAATCAATGAGGTAGG + Intergenic
981682034 4:147410294-147410316 GGGAGATAATTGAATGATGAGGG - Intergenic
981954271 4:150450485-150450507 GAGAGAACACTATATGACGATGG - Intronic
982335382 4:154231287-154231309 AGGAGAAAAGTGAAAGAGGAAGG - Intergenic
982533444 4:156577518-156577540 GAGAGAAAAACAAATGAAGAAGG + Intergenic
982671089 4:158320668-158320690 GAGAGATAACTGAATTATGAGGG + Intronic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
982954247 4:161742170-161742192 GAGAGAAAACTTGTTAAGGAGGG + Intronic
983001024 4:162413877-162413899 GAGAGAAAAGTGGAGGAGGCGGG + Intergenic
983021660 4:162684407-162684429 GGGAAAGAACTGAAAGAGGAGGG + Intergenic
983730920 4:170992136-170992158 GAGAAAATGCTGAATGTGGATGG - Intergenic
984568960 4:181366713-181366735 GATAAAAAACAGAGTGAGGAAGG - Intergenic
984837111 4:184032486-184032508 GAAAGAAAAAAGAATGAAGAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985278784 4:188266820-188266842 GAAAGAAAAGTGAATTAGGGAGG - Intergenic
985421587 4:189790039-189790061 GAGAGAAAACTGAGCTGGGATGG + Intergenic
986184242 5:5421920-5421942 GAGAGAAAACGGAAAGATAAAGG - Intronic
986188327 5:5466890-5466912 GAGAGAAAGCTGAAAGGAGACGG + Intronic
986597784 5:9441537-9441559 GAGTGCAAACTGAATGAGATAGG + Intronic
986887383 5:12256357-12256379 GGGAGATAACTGAATCATGAGGG + Intergenic
987252138 5:16110891-16110913 GAGAGAGAACTGAATCATGGGGG + Intronic
987512216 5:18855196-18855218 GAGAGAAAATTGAATCATGGGGG + Intergenic
987851707 5:23363118-23363140 GAGAGGTAATTGAATCAGGAGGG - Intergenic
988131286 5:27109636-27109658 GAGAAATGACTGAATGAAGAAGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988238280 5:28575176-28575198 GAGAAAATGCTGAATGTGGATGG + Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989204072 5:38794339-38794361 GGGAGATAACTGAATCACGAGGG - Intergenic
989437306 5:41429733-41429755 AAGAGAAAAAGGAATGACGAAGG + Intronic
989634340 5:43518499-43518521 GCAAGAGAACTGAATGAGAAGGG + Intergenic
989753543 5:44923498-44923520 GGGAGACAACTGAATGATGGGGG + Intergenic
990850135 5:60193876-60193898 GAGAGTAAGCTGGGTGAGGAAGG - Intronic
991578669 5:68131514-68131536 CAGAGATACCTGAATGAGGTAGG - Intergenic
992105350 5:73445893-73445915 GAGTGGAAATTAAATGAGGAAGG + Intronic
992372215 5:76154927-76154949 AAGAGAAAAATAAAAGAGGAGGG + Intronic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
994384599 5:99115404-99115426 GAAAGAGAATTGAATGAGAAGGG + Intergenic
994494020 5:100487879-100487901 GGGAGATAACTGAATCATGAGGG - Intergenic
995283812 5:110364325-110364347 GAGAGATAACACACTGAGGATGG - Intronic
995505457 5:112855632-112855654 GAGAGAAAAATTAAGGAGGAGGG + Intronic
995508950 5:112888909-112888931 GAGAGATAACTGAATCATGGGGG + Intronic
995656838 5:114435155-114435177 GAGAGAAAACAAACTCAGGAAGG - Intronic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
996096840 5:119407949-119407971 GAGAAAAAAGTGAATCTGGAAGG + Intergenic
996118101 5:119641102-119641124 GAGAGACAACTGCAGGAGAAAGG - Intergenic
996199459 5:120653133-120653155 GAGAGGAAAGTGACTGTGGAAGG + Intronic
996295113 5:121904310-121904332 GAGAGAAAAAAGAAACAGGAAGG - Intergenic
996394194 5:122996231-122996253 GATAGAAAACTGAAACAAGAAGG + Intronic
996576926 5:124985787-124985809 GAGAGGAATCTGAATGAACAGGG + Intergenic
997184051 5:131863755-131863777 GAGAGATAACTGAATCATGGGGG + Intronic
997397510 5:133575987-133576009 GAGAGATAACGGATTCAGGAAGG - Intronic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998187448 5:139992446-139992468 GAGAGACAAAAGAATGAGAAGGG - Intronic
998728025 5:145041372-145041394 GAGAGAAAACCAGATGAGTATGG + Intergenic
998884054 5:146675806-146675828 GAGAGAGAAGTGACTGAGGTTGG - Intronic
998904283 5:146888006-146888028 GTGAAAAAACTGTATTAGGAAGG - Intronic
998958120 5:147457717-147457739 GAGAGGAAACTTTATGAGGCAGG + Intronic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
999891467 5:155982552-155982574 GAGAGAGAGCTGGCTGAGGAAGG - Intronic
1000731416 5:164838734-164838756 GAGAGGAAAATGAAGGCGGAAGG - Intergenic
1001024018 5:168207821-168207843 GAGAGACAAAGGAAGGAGGAAGG - Intronic
1001184448 5:169555159-169555181 AAGGGAAGACTGAATAAGGAGGG - Intergenic
1001699688 5:173697837-173697859 AAATGAAAACTGAATGAGGAAGG - Intergenic
1001968258 5:175930565-175930587 GAGAGAAATCAAAATAAGGATGG + Intronic
1002249184 5:177913225-177913247 GAGAGAAATCAAAATAAGGATGG - Intergenic
1002337627 5:178491170-178491192 GAGAGAGAAGAGAACGAGGAGGG + Intronic
1002793934 6:455850-455872 TAGAAAAGAATGAATGAGGATGG - Intergenic
1002932271 6:1642900-1642922 GGGAAAAAACTCAGTGAGGAAGG - Intronic
1003280670 6:4688845-4688867 GAAAGAAGAATGAATGAGCATGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004107700 6:12681214-12681236 GAAAGAAAACTGAAAGGGGGTGG + Intergenic
1004123921 6:12853774-12853796 TAGAGATAACTGAATCAGGGGGG - Intronic
1004167196 6:13267138-13267160 CAGAGAAGACTGGAAGAGGATGG - Exonic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1004854236 6:19733186-19733208 GAAAGAAATAGGAATGAGGAGGG - Intergenic
1004904460 6:20223337-20223359 GAGAGAAAACAGAAAGAGAGGGG + Intergenic
1004962345 6:20804323-20804345 GAGAGAAAATAGAATGAGAGAGG + Intronic
1005525249 6:26641276-26641298 GAGAAAGAACTGAATGAGGTGGG + Intronic
1008073341 6:47119648-47119670 GGGAGAAAAATGAATAAAGATGG + Intergenic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1008478402 6:51958452-51958474 GAGAGAAAAGTGTAGGAGAAAGG - Intronic
1008593626 6:53018777-53018799 GAGAGAAAAGAGAAAGTGGAAGG + Intronic
1009199295 6:60724404-60724426 TGGAGAAAACTGATTGTGGAAGG - Intergenic
1010909681 6:81537725-81537747 GAGAGATAATTGAATCATGAGGG - Intronic
1011227216 6:85120462-85120484 TAGTGAAAGCTGCATGAGGAAGG - Intergenic
1013008519 6:106098285-106098307 GAGAGAAAACTTTGTGTGGAAGG + Intronic
1013712092 6:112913592-112913614 GTGACAAAACTGAATGAGGTAGG + Intergenic
1013864775 6:114682558-114682580 GGGAGAAAAATAAATAAGGAAGG - Intergenic
1014629898 6:123775348-123775370 TAGAGCAGAGTGAATGAGGAGGG - Intergenic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1015003540 6:128249959-128249981 GAGAGGTAACTGAATCATGAAGG + Intronic
1015124624 6:129739634-129739656 AAGAAAATACTGAATGAGAATGG - Intergenic
1015195607 6:130521970-130521992 GAGAGAAAATTGAATCATGGGGG - Intergenic
1015655039 6:135508499-135508521 GAGGAAAAATTGAATAAGGAAGG + Intergenic
1016777733 6:147923597-147923619 GTGAGAAAACTGGTTGAGGGAGG + Intergenic
1017337423 6:153278020-153278042 GAGAGAAAATAGAACGAGGTAGG + Intergenic
1017826982 6:158089007-158089029 GAGAGAGAAATGGATGAGTATGG - Intronic
1018171508 6:161146861-161146883 GAGGGAAGACGGAATGAGGCAGG - Intronic
1018419140 6:163626917-163626939 AAGAGAAATCTGACTCAGGAGGG + Intergenic
1018573608 6:165235576-165235598 GAGAGATAACTGAATCATGGGGG + Intergenic
1019551879 7:1607086-1607108 GAGAGAAAGAGGAAAGAGGAGGG - Intergenic
1019867359 7:3724761-3724783 GAAGGAAAAAGGAATGAGGAGGG + Intronic
1019963562 7:4481207-4481229 GGGAGATAACTGAATCATGAGGG + Intergenic
1020345580 7:7159416-7159438 GAAAGAAAACAGGAAGAGGAGGG + Intronic
1020460377 7:8423559-8423581 TAGTGAAAACTGAATAAAGATGG - Intergenic
1020585810 7:10065136-10065158 GTGAGAAAACTAACTGAGGGTGG + Intergenic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1021514849 7:21472860-21472882 GAGTCAAAATTGAATAAGGATGG + Intronic
1022319257 7:29273091-29273113 GAGAGAAAACGGAAAGATGTAGG - Intronic
1022419183 7:30204688-30204710 GAGAGAAAACATAAAGAGAATGG - Intergenic
1022534726 7:31090242-31090264 GAGAGAAAATTGAATAAGATGGG - Intronic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023344238 7:39254678-39254700 GCCAGAAAACAGATTGAGGATGG - Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024413905 7:49080109-49080131 GAGAGGTAACTGAATCATGATGG - Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024714651 7:52062446-52062468 GAGAAAAAAATGAATTAGGATGG + Intergenic
1024819501 7:53310845-53310867 GAGATAAAACTGAAATGGGATGG - Intergenic
1025624138 7:63203442-63203464 TAGAGAAAAATGAAGGAGAAGGG - Intergenic
1026081250 7:67223532-67223554 AAGAGAAAAGTGAAAGAGTAGGG + Intronic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026661895 7:72309777-72309799 GAGAGATGACTAAATGAGGTTGG - Intronic
1026695830 7:72590471-72590493 AAGAGAAAAGTGAAAGAGTAGGG - Intronic
1027375884 7:77549020-77549042 GAGATAAAAGTGAATGAGACAGG - Intronic
1027937685 7:84631243-84631265 GGGAGACAACTGAATCATGAGGG + Intergenic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028132761 7:87195861-87195883 GAAGTAAAACTAAATGAGGAAGG + Exonic
1028421873 7:90642021-90642043 GGGAGATAACTGAATCAGGGAGG - Intronic
1028707986 7:93873439-93873461 GGGAGATAACTGAATCATGAGGG + Intronic
1028714482 7:93948892-93948914 GAGAGAAAAAGGAAGAAGGAAGG + Intergenic
1029227976 7:99041959-99041981 AAGTGAAAACTGAATTAAGATGG - Intronic
1029787687 7:102809042-102809064 GAGTGAAAACTGAATGTGATGGG - Intronic
1029858205 7:103540371-103540393 GAGAGAATACTGTAGGAGCACGG + Exonic
1030350855 7:108484596-108484618 GATAGAAAATGGGATGAGGAAGG - Intronic
1031210570 7:118820682-118820704 GGGAGATAACTGAATCATGAGGG + Intergenic
1031369659 7:120949369-120949391 GAAAGAAAAGGGAATAAGGAAGG + Intergenic
1031431918 7:121682324-121682346 CAGTGCAAACTGATTGAGGAAGG + Intergenic
1031647709 7:124246914-124246936 TAAAGAAAAGTGAATGAGGTGGG - Intergenic
1031847377 7:126822460-126822482 GAAAGAAAAATAAAAGAGGAAGG - Intronic
1031925417 7:127633986-127634008 GGGAGACAACTGAATGATGGGGG - Intergenic
1031978974 7:128112180-128112202 GGGAGAAGACTGTCTGAGGAAGG + Intergenic
1032059003 7:128707958-128707980 GAGAGAGAAATAAAGGAGGAAGG - Intergenic
1032439683 7:131932999-131933021 GAGATAAAATTGCATGAGGAGGG - Intergenic
1032928402 7:136636777-136636799 GAGAGAGAAAAGAATGAAGAGGG + Intergenic
1033064872 7:138145012-138145034 GATAGAAAAGTGAGTGAGAATGG - Intergenic
1033623524 7:143085255-143085277 GAAAGAAAACTGAATAGGGAAGG + Intergenic
1033669995 7:143482563-143482585 GAGAGAAGAATGAAGAAGGATGG - Intergenic
1033854392 7:145540727-145540749 GAAAGAAAAATGAAAGAAGAAGG - Intergenic
1033923060 7:146419291-146419313 GGGAGATAATTGAATGATGAGGG - Intronic
1035978413 8:4339703-4339725 GAGAAGAAAATGAAAGAGGACGG + Intronic
1037067444 8:14599586-14599608 GGGAGAAAACTGAATAAGGCTGG + Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039328586 8:36512257-36512279 GAGAGAAAATTGAATCATGAGGG - Intergenic
1039741194 8:40384453-40384475 GACAGAAAACAGTGTGAGGATGG + Intergenic
1040384026 8:46901067-46901089 GAGAGAAACCTGAAGTAGGAGGG - Intergenic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041122369 8:54600126-54600148 GGGAGGTAACTGAATGATGAGGG + Intergenic
1041145748 8:54874618-54874640 GAGAGAAAACAGACTGTGGCAGG - Intergenic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041875829 8:62685878-62685900 GAGAGAAAACAGGAAGGGGATGG - Intronic
1042060985 8:64817516-64817538 GACAGAAAAATGTATGAGAAAGG + Intergenic
1042421046 8:68589786-68589808 GAGAGAGAAGGGAATCAGGAAGG + Intronic
1042857496 8:73282836-73282858 GAGTCAAAGCTGAATGAGGCTGG + Intergenic
1043035666 8:75195303-75195325 GAGAGAGAAATAAAAGAGGATGG + Intergenic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1044742539 8:95342593-95342615 TTGAGAACAGTGAATGAGGAGGG + Intergenic
1044805094 8:95998641-95998663 GACAGAAAACTAAATGAGGCAGG + Intergenic
1045597335 8:103671200-103671222 GGGAGATAACTGAATCATGAGGG - Intronic
1045665951 8:104484741-104484763 GTGAGAAAACTGAATGATTGTGG + Intergenic
1046309558 8:112416180-112416202 GAGAGGTAACTGAATCATGAGGG + Intronic
1046420676 8:113979918-113979940 GAGAAAATGCTGAATGTGGATGG + Intergenic
1047627920 8:126676127-126676149 GAGAGGTAACTGAATGATGGGGG + Intergenic
1047635194 8:126754123-126754145 GACAGAGAACTGAATGAAAAAGG + Intergenic
1047857713 8:128930479-128930501 GAAAGAAAAAGGAAGGAGGAGGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048305366 8:133280182-133280204 AAGAGAAGACGGGATGAGGAAGG + Intronic
1048378137 8:133840425-133840447 GAGTCAAATCTGAAGGAGGAAGG - Intergenic
1049702232 8:144020544-144020566 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702394 8:144021141-144021163 GAGAGGATACTGAAGGAAGAGGG - Intronic
1050970694 9:11868985-11869007 GCAACAAAACTGAAAGAGGAAGG - Intergenic
1051225096 9:14890775-14890797 TAGAGAAAACTGATTGCAGAGGG + Intronic
1051318138 9:15866100-15866122 GAGATAAAGCTCAATGAGGCAGG + Intronic
1051337464 9:16078903-16078925 GAAAGAATGCTGAATCAGGAAGG + Intergenic
1051969182 9:22865791-22865813 TTGAGAAGACTGAATGGGGAGGG + Intergenic
1052411027 9:28121463-28121485 GAAAGAAAAAAGAATGTGGAAGG - Intronic
1052446472 9:28567886-28567908 GAGTAAGAACTGCATGAGGAGGG - Intronic
1053158167 9:35794113-35794135 GAGCCAAATCTGAAGGAGGAGGG + Intronic
1053579065 9:39384431-39384453 AAGAGAAAATTGAAAAAGGAAGG + Intergenic
1053606677 9:39666978-39667000 GAGAATGAAATGAATGAGGAGGG + Intergenic
1053843580 9:42212516-42212538 AAGAGAAAATTGAAAAAGGAAGG + Intergenic
1054100648 9:60943236-60943258 AAGAGAAAATTGAAAAAGGAAGG + Intergenic
1054246858 9:62675426-62675448 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054560979 9:66709960-66709982 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054585699 9:66963649-66963671 AAGAGAAAATTGAAAAAGGAAGG - Intergenic
1054951956 9:70862145-70862167 GAGAGAAAACTAGCTGAGGGTGG - Intronic
1055108151 9:72533775-72533797 GAGAGAAAAGAGAGAGAGGAAGG - Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055910727 9:81347792-81347814 GATAGAAAATAGAATGAGGCTGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056650686 9:88458674-88458696 GAGAGAAAAACACATGAGGAGGG + Intronic
1056682140 9:88728979-88729001 GATAGGAACCTGAATGAGGGAGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1058668887 9:107344113-107344135 GAGAGAATAATGAATAAGGCAGG + Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1060269322 9:122129653-122129675 GAGAGAAAACTGAGTGGGAGGGG + Intergenic
1061477530 9:130878390-130878412 GAAAGAAAACCGAAAGAGAAAGG - Intronic
1061915852 9:133753418-133753440 GAGAGAACACTGTGTGAAGATGG - Intergenic
1203489268 Un_GL000224v1:87808-87830 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1203501889 Un_KI270741v1:29703-29725 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1185740286 X:2526503-2526525 GGGAGATAACTGAATCATGAGGG + Intergenic
1186101569 X:6162965-6162987 GGGAGATAACTGAATCAAGAGGG + Intronic
1186117085 X:6316033-6316055 CTCAGAAAACTGAATGAGGGGGG - Intergenic
1186335056 X:8577491-8577513 CAGAGATAACTGAAATAGGAAGG + Intronic
1186607663 X:11108963-11108985 GTGAGAGAACAGAATGATGAGGG + Intergenic
1187002131 X:15193107-15193129 GAGACATAACTGAAGGCGGACGG - Intergenic
1187020765 X:15379068-15379090 GAGACATAACTGAATCAGAAAGG + Intronic
1187894550 X:23968082-23968104 GGGAGATAACTGAATCATGAGGG - Intergenic
1188081399 X:25845786-25845808 GGGTGAAAACTGAATGAAAAAGG - Intergenic
1188747262 X:33861497-33861519 GAGAGAGAACATAAAGAGGAGGG + Intergenic
1188960906 X:36490460-36490482 GGGAAAAAAATGAAAGAGGAAGG - Intergenic
1189582328 X:42419991-42420013 GAGAGAAAAACAACTGAGGATGG - Intergenic
1189674462 X:43446845-43446867 GAGAGATAACTGAATCATGGAGG + Intergenic
1190215912 X:48479227-48479249 GGGAGAAAGCTGAGTGCGGAAGG - Intronic
1190453047 X:50599779-50599801 GAGAGAAGACTTACAGAGGAGGG - Intronic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193255911 X:79349390-79349412 GATAGAAAACTAAATGAAGCAGG - Intergenic
1193279238 X:79627569-79627591 GAGAGATAATTGAATCATGAGGG + Intergenic
1193334564 X:80273571-80273593 GAGAGCAAGCTGAAAGAGGGTGG + Intergenic
1194257056 X:91646968-91646990 GAGAGATAACTGAATCATGGGGG + Intergenic
1194621987 X:96184232-96184254 GGAATAAAAATGAATGAGGAAGG - Intergenic
1194703286 X:97142382-97142404 GAGAGAAAACAACATGAGCAAGG + Intronic
1194708823 X:97208147-97208169 GAAAGAAAAGTGAATCAGCATGG + Intronic
1194742890 X:97596332-97596354 GAGAGAAAAATGGAAGAGGAGGG - Intronic
1195868828 X:109464280-109464302 GAAAGAAAAAGGAGTGAGGAGGG - Intronic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1196491397 X:116271594-116271616 GAGAGAGAAATGAAGAAGGAAGG - Intergenic
1197314053 X:124942016-124942038 GAGAGAAAATTGAATCATGGGGG - Intronic
1197658965 X:129149340-129149362 GGAAGAAAGTTGAATGAGGATGG - Intergenic
1197744066 X:129919118-129919140 GAGAGAAAGCTGTAAGAGCATGG + Intronic
1198121457 X:133596538-133596560 GATAAAAACCTGGATGAGGAAGG - Exonic
1198594964 X:138226300-138226322 GAGAGAAAAATGGAAGAGGAAGG + Intergenic
1199539955 X:148947720-148947742 GAGACAAAAACGAAGGAGGAAGG + Intronic
1200575766 Y:4886234-4886256 GAGAGAGAACTGAATCATGGGGG + Intergenic
1201927927 Y:19310487-19310509 GGGAGACAACTGAATCATGAGGG - Intergenic
1202577938 Y:26347149-26347171 GAGATAAAACTAATTGAGGCTGG + Intergenic