ID: 982937455

View in Genome Browser
Species Human (GRCh38)
Location 4:161500128-161500150
Sequence TGTTTTTATTCCTAAGGTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982937455 Original CRISPR TGTTTTTATTCCTAAGGTCT GGG (reversed) Exonic
900254888 1:1692904-1692926 TTTTTTTTTTTTTAAGGTCTAGG + Intronic
900263636 1:1746183-1746205 TTTTTTTTTTTTTAAGGTCTAGG + Intergenic
900320302 1:2080178-2080200 AGTTTTTCTTCCTTTGGTCTTGG + Intronic
903598929 1:24519443-24519465 TTTTTTTCTGCCTTAGGTCTTGG + Intronic
904953424 1:34262834-34262856 TGTCTTTATTCCTGGGGTCAAGG - Intergenic
907935740 1:59040738-59040760 TGTTTTTACTTCTCTGGTCTAGG - Intergenic
908104285 1:60825406-60825428 TGCTTTTATTCCTCATATCTGGG - Intergenic
908815268 1:68025348-68025370 TTTTTTTTTTCCTAAGCTCTGGG + Intergenic
908888359 1:68815824-68815846 TTTTTGTATGCCTAAGGCCTTGG + Intergenic
909399322 1:75208929-75208951 TTTATTTATTCCTATTGTCTTGG - Intronic
909520572 1:76563573-76563595 TGTTTTTATTTCTACTGTTTGGG - Intronic
909895497 1:81064096-81064118 CATTTTTATTCCTAAGTTATGGG - Intergenic
910060942 1:83090759-83090781 TGTTTTGATTCAGTAGGTCTGGG + Intergenic
910154405 1:84197447-84197469 CTTTTTTATTCCTTGGGTCTAGG + Intronic
910738263 1:90486407-90486429 TGTTTTTCCTTCTAAGGACTTGG - Intergenic
911718527 1:101164218-101164240 TATTTTTATTTCAAAGATCTAGG + Intergenic
912320186 1:108705764-108705786 TATTTTTCTTCCTAGGGACTGGG + Intergenic
912757538 1:112336944-112336966 TCTGTTTATTCCTTAGGTCGGGG - Intergenic
913649938 1:120903668-120903690 TTTTTTTAATCTTAAGTTCTAGG - Intergenic
914076743 1:144359843-144359865 TTTTTTTAATCTTAAGTTCTAGG + Intergenic
914102435 1:144606654-144606676 TTTTTTTAATCTTAAGTTCTAGG - Intergenic
914171191 1:145225418-145225440 TTTTTTTAATCTTAAGTTCTAGG + Intergenic
914296461 1:146330544-146330566 TTTTTTTAATCTTAAGTTCTAGG + Intergenic
914526299 1:148469392-148469414 TTTTTTTAATCTTAAGTTCTAGG + Intergenic
914640101 1:149597725-149597747 TTTTTTTAATCTTAAGTTCTAGG - Intergenic
915064940 1:153217197-153217219 AGATTTTATGCCTAAGGCCTGGG - Intergenic
915159418 1:153906779-153906801 TGTTTTTGTTTCTAAGTTGTAGG - Intronic
916280529 1:163046490-163046512 TGTTTTTATTCCTAAAGAAGTGG - Intergenic
916534861 1:165694193-165694215 TTTTTTTATACTTAAGTTCTAGG - Intronic
917667026 1:177235169-177235191 GATTTTCATTCCTTAGGTCTGGG - Intronic
918101457 1:181379139-181379161 TATTTTTATTGCTATGGACTTGG - Intergenic
918410406 1:184252574-184252596 TTTTTTTTTTACTAAGTTCTGGG - Intergenic
921193804 1:212732958-212732980 TCTTGGTATTCCTCAGGTCTGGG + Intronic
923703980 1:236328285-236328307 GGACTTTATTCCTAAGGTATGGG + Intergenic
924007875 1:239632154-239632176 TGTTCTTTTTCCCAGGGTCTTGG + Intronic
1064373958 10:14778925-14778947 TGTTTTTGTTCTTAAGATATCGG + Intergenic
1068227710 10:54127952-54127974 TAATTTTATTTCTAAGGACTGGG + Intronic
1069083878 10:64117032-64117054 TGCTTTTGTTCTTAAGGTATTGG - Intergenic
1072456437 10:95580391-95580413 TGCTTTTATTTTTAAGGGCTGGG - Intergenic
1072747780 10:97953524-97953546 TGTTTTGAGTCCCAAGGTCAGGG - Intronic
1073385407 10:103123292-103123314 TTTTTTTTTTCCTAAGTTCCAGG + Intronic
1073660131 10:105466113-105466135 TGTTTGTATTTTTAAAGTCTTGG + Intergenic
1074478647 10:113797170-113797192 TGCTGTTATTCCTAAAATCTTGG + Intergenic
1077643968 11:3907139-3907161 CCTTTTTATTCTTAAGGTATTGG - Intronic
1078888727 11:15534047-15534069 AGTTTTTATTACTAATGTTTGGG - Intergenic
1079287255 11:19147267-19147289 TGTTTATATTCAAAAGGTTTAGG - Intronic
1079543987 11:21610642-21610664 AGTCTGTATTCCTAAGGCCTAGG - Intergenic
1082168518 11:48972615-48972637 TGATTTTGTTCCTAATGTCCAGG - Intergenic
1082181781 11:49128773-49128795 TTTTTTTATACTTAAGTTCTAGG + Intergenic
1082306142 11:50578203-50578225 TGTTTTTAATCCTAGGATATAGG + Intergenic
1082765239 11:57162587-57162609 TGTTCTTATTGATCAGGTCTGGG + Intergenic
1083472641 11:62894385-62894407 TGTTTTGATTCAGAAGGTCTGGG + Intergenic
1083762623 11:64826937-64826959 TGTAATTACTCCTAAGGCCTGGG - Intronic
1084079664 11:66813242-66813264 TGTTTTAAGTTCTAAGTTCTTGG - Intronic
1084340568 11:68496803-68496825 TGTCTTTATTACTAAGTTGTAGG + Intronic
1085200646 11:74699820-74699842 TGTTTTAACTCCCACGGTCTGGG + Intronic
1086013205 11:82131235-82131257 TGTTTTTCTTCCGAAGATATTGG + Intergenic
1086665033 11:89469904-89469926 AGTTGTTATTCCTTAGGTCTCGG + Intronic
1086683716 11:89706093-89706115 TTTTTTTATACTTAAGTTCTAGG - Intergenic
1087287449 11:96280508-96280530 TGTATTTTTTCCTGAGGTCAGGG + Intronic
1087634200 11:100685240-100685262 TGTCTACATTACTAAGGTCTGGG - Intergenic
1087989119 11:104725869-104725891 TGTTTATATTCTTGAGGCCTTGG + Intergenic
1088119517 11:106351685-106351707 AGTTTTTATTGGTAAGGTCCAGG + Intergenic
1088250106 11:107855186-107855208 GGTCTTTATTCCAAGGGTCTTGG - Intronic
1088317437 11:108521337-108521359 TGTTTTCTTTCTCAAGGTCTAGG + Intronic
1090250261 11:125246013-125246035 GGTTCTTCTTCCTGAGGTCTGGG - Intronic
1090655558 11:128841628-128841650 TGTGTTTATTCGTAAGAACTAGG + Intronic
1091824193 12:3498056-3498078 TGTTTCTCTGCATAAGGTCTAGG + Intronic
1093472162 12:19513781-19513803 TGTGTATATTCCTAATGTTTTGG + Intronic
1093509631 12:19911200-19911222 TGCTTTTATTCCCAATGTTTTGG + Intergenic
1095636464 12:44439970-44439992 TGTTTTAATTCTTAAGGGCCAGG + Intergenic
1095727736 12:45471422-45471444 CCTTTTTATTCTTTAGGTCTTGG - Intergenic
1095814726 12:46408687-46408709 TATTTTTATTCCTTTGGTCCTGG + Intergenic
1097339064 12:58417048-58417070 TGCCATTATTCCTAAGTTCTGGG - Intergenic
1097471266 12:59995187-59995209 GGTTTTTCTTTCTAAAGTCTTGG + Intergenic
1097476321 12:60060275-60060297 TTTTCTTCTTCTTAAGGTCTAGG - Intergenic
1098095304 12:66948111-66948133 TGTGTTTATTCCCAAGGCCAGGG + Intergenic
1099296673 12:80836847-80836869 CTTTTTTACTCCTAAGGTGTGGG - Intronic
1099900113 12:88696730-88696752 TGCTTTTATACCTAAATTCTTGG - Intergenic
1100309729 12:93383079-93383101 TTTTTTTTTTCTTAGGGTCTTGG + Intronic
1101493058 12:105227797-105227819 TGTTATTATGCCTATGGTATTGG - Intronic
1105249792 13:18687939-18687961 TGTTCTTATTCCTTAGTTCAAGG + Intergenic
1106409484 13:29501314-29501336 TGTTCTTGTTCTTCAGGTCTTGG - Intronic
1106973177 13:35170435-35170457 TATTTTTGTTCCTTAGGACTAGG - Intronic
1108534643 13:51361813-51361835 TGTTGTTATTGAAAAGGTCTCGG + Exonic
1109266779 13:60210168-60210190 TATTTTTATTGCTAAGTTGTAGG - Intergenic
1109948024 13:69463491-69463513 GGTTTTTATTCCTGAGGCTTGGG + Intergenic
1111108045 13:83671705-83671727 TCTTTTTATTCCACTGGTCTTGG - Intergenic
1111561671 13:89957791-89957813 TGTTTTTAGGCCTAACGTATTGG - Intergenic
1112096157 13:96134501-96134523 TCTTTTTATTTCTAAGCTCTTGG + Intronic
1113735416 13:112674956-112674978 TGTTGTTATTCCTGAGGACTTGG - Intronic
1113772812 13:112921710-112921732 TGATTTTATTCTTAACGTCTAGG - Intronic
1114343935 14:21775835-21775857 TCTTTTTATTATTAAGGTGTAGG - Intergenic
1115265836 14:31499321-31499343 TGGTGTTATTTCTGAGGTCTTGG - Intronic
1115516764 14:34193036-34193058 TGGTTTTATTATTAAGTTCTAGG + Intronic
1116082068 14:40186762-40186784 TGTTTTTACTACTAAGTTGTGGG + Intergenic
1116227062 14:42166037-42166059 TTTTTTTATACTTAAGTTCTGGG + Intergenic
1117493254 14:56273857-56273879 GATTTTTATTCCAGAGGTCTGGG + Intronic
1117512718 14:56470080-56470102 TGTATTTTTTGCTTAGGTCTTGG + Intergenic
1117831887 14:59759673-59759695 TCTTTTTATTCCTGATTTCTAGG - Intronic
1118274921 14:64377714-64377736 TGATTTTCTTCTTTAGGTCTTGG - Intergenic
1118644872 14:67828599-67828621 TGTTTTTTTTCCTATAGTTTTGG + Intronic
1121042358 14:90759475-90759497 AGTTTTTATTCTTAGGGTTTGGG - Intronic
1122082170 14:99273691-99273713 TGTTTTCGTCCCGAAGGTCTTGG + Intergenic
1122109236 14:99484388-99484410 TGTTTTGATTCCTAATATTTAGG + Intronic
1124936154 15:34173097-34173119 TTTTTTTCTTCCTATGTTCTGGG - Intronic
1125505040 15:40262930-40262952 TTGTTTTATTCCAAAGGGCTTGG + Intronic
1125835051 15:42741899-42741921 TGTTTTTAATTCAAAGCTCTGGG + Exonic
1126399148 15:48251459-48251481 TGATTATTTTCCTATGGTCTTGG - Intronic
1126606118 15:50478284-50478306 TTTTTTTATTTGTAATGTCTTGG - Intronic
1126838536 15:52692909-52692931 TGTTTGTAATCCCAAGGTTTTGG - Intronic
1127654364 15:61042361-61042383 TGTATTTATTCATTAGGACTAGG - Intronic
1128285302 15:66431696-66431718 TGTTTTTATTTTTAAGTTCAGGG + Intronic
1129374176 15:75117196-75117218 TAATTTTATTCCTAAGTTGTTGG + Intronic
1130172326 15:81528192-81528214 TTCTTTTTTCCCTAAGGTCTAGG + Intergenic
1130400595 15:83549479-83549501 TGCTTTTACTCCTAGGGTTTAGG + Intronic
1131949367 15:97664278-97664300 TGTTCTTATTTCTATGTTCTTGG - Intergenic
1133718756 16:8474636-8474658 TGTTTCTCTTCCTGAGCTCTTGG + Intergenic
1133794056 16:9032192-9032214 TGTTTTTAGTTCTTATGTCTGGG + Intergenic
1134282758 16:12832374-12832396 TGTTGTTATTCCCAGGGACTGGG - Intergenic
1135716363 16:24772221-24772243 TGTTTTTATTCCCATTGTTTGGG + Intronic
1136727896 16:32376365-32376387 AGTTTTTATCCCTAAAGCCTTGG - Intergenic
1137310195 16:47248420-47248442 TTTTTTTATTGGTAAGGTTTTGG - Intronic
1138760791 16:59541240-59541262 TGTTTTTATTTAAAAGGACTTGG + Intergenic
1139165105 16:64556867-64556889 TACTTTTATTCCAAACGTCTGGG + Intergenic
1139266192 16:65640656-65640678 TGCTTTTCTTCCTTAGGCCTAGG + Intergenic
1139426878 16:66886338-66886360 TATTTAAATTACTAAGGTCTAGG + Exonic
1140042024 16:71414374-71414396 TGATTTCATTCTTAAGGTCCAGG + Intergenic
1140794993 16:78429005-78429027 TGTTTTTTTTATTAAGGACTTGG + Intronic
1202998539 16_KI270728v1_random:141389-141411 AGTTTTTATCCCTAAAGCCTTGG + Intergenic
1203130136 16_KI270728v1_random:1677793-1677815 AGTTTTTATCCCTAAAGCCTTGG + Intergenic
1142943209 17:3400781-3400803 TTTTTTTATTTTTAAGTTCTGGG + Intergenic
1143272066 17:5683238-5683260 TGTTTTTTTTCCTGAGGAGTGGG + Intergenic
1146258389 17:31405008-31405030 TGATTTTATCCCAAAGGTTTCGG + Intronic
1146271077 17:31486404-31486426 TGTTTTTATTTCTAATTTTTTGG + Intronic
1146533034 17:33626911-33626933 TGTTTTTATTCTGAAGGTGAGGG - Intronic
1147136003 17:38434516-38434538 TGTTTCTATCCCTCAGGCCTCGG - Intronic
1147218288 17:38913362-38913384 AGTTTTTATCCCTAAAGGCTGGG + Intronic
1147805759 17:43129852-43129874 TGATTTTTTGCCTAAGGTCCTGG + Intergenic
1147811415 17:43172524-43172546 TGATTTTTTGCCTAAGGTCCTGG + Intronic
1148030164 17:44614275-44614297 TCTATTTATTCTTCAGGTCTCGG + Intergenic
1148837890 17:50475981-50476003 TGTTTTTATTTCTTGGGTCAAGG - Intergenic
1149657433 17:58317710-58317732 TGTTATTATTACTAAGCTCCTGG - Intronic
1150111274 17:62502100-62502122 TTTCTTTTTTCCTAATGTCTTGG - Intronic
1150827602 17:68490592-68490614 TTTTTTTTTTCTTAAGGTTTGGG + Intergenic
1154439039 18:14370951-14370973 TGTTCTTATTCCTTAGCTCAAGG - Intergenic
1155289927 18:24330717-24330739 TGTTTTCATTTCTAGGGGCTGGG - Intronic
1156437452 18:37147982-37148004 TATTTTTATTTTTAAGTTCTAGG + Intronic
1157023609 18:43816129-43816151 TCTTTCTATGCCTAAGGTTTAGG + Intergenic
1157068703 18:44381169-44381191 TTTTTTTTTTCTTAAGTTCTGGG - Intergenic
1157530412 18:48415591-48415613 TGTTATTATTCATAATGTCGTGG + Intergenic
1157870276 18:51223817-51223839 TGTTTTTCTTCTAAAGATCTTGG + Intergenic
1159062625 18:63532027-63532049 TGATACTATTCCTAAGATCTTGG - Intergenic
1159828707 18:73246641-73246663 TATTTTTGTTCTTAATGTCTTGG - Intronic
1159973741 18:74685150-74685172 TGTTTTTATTATAAAGGTCAGGG + Intronic
1167318941 19:48783640-48783662 TTTTTTTCATCCTAAGATCTGGG - Intergenic
925231037 2:2233923-2233945 TGTTTTTCTTCATAAGGCCATGG + Intronic
925685856 2:6472832-6472854 TTTTTTAATTCATAAGGTATAGG - Intergenic
925774552 2:7321751-7321773 TGTTTTTTTTAGAAAGGTCTTGG - Intergenic
925873031 2:8287098-8287120 TATTTTTATTCCAAAAGTCCTGG + Intergenic
926364528 2:12121088-12121110 TTTTTTTCTTCCTAAACTCTGGG - Intergenic
926559671 2:14402280-14402302 TGTTTTTATTCTTTAGGTTCAGG + Intergenic
926783387 2:16496435-16496457 TGTTTCTTTTACTAAGGTCCAGG - Intergenic
926876058 2:17480441-17480463 TTTTTTTATTCATTAGGTTTGGG - Intergenic
928360504 2:30658742-30658764 GGTTTTTTTTCCTATGGTATGGG - Intergenic
928478162 2:31652573-31652595 TGTTTTCATTTCTAAGGCCTCGG - Intergenic
929609028 2:43256126-43256148 TGTTTTTATTCCTTCTATCTTGG - Intronic
930542011 2:52718417-52718439 TTTTTTTTTTCCTAAGCTCTCGG - Intergenic
931554452 2:63486408-63486430 TGTTTATATTCCTAAGTAATAGG + Intronic
932061214 2:68500029-68500051 TGTTTTCATTCCTAATTTTTTGG + Intronic
933114371 2:78448903-78448925 TATTTTTATACTTAACGTCTGGG - Intergenic
934318079 2:91944708-91944730 AGTTTTTATCCCTAAAGCCTTGG + Intergenic
934475828 2:94592775-94592797 AGTTTTTCTTCCTAAGGGCTGGG - Intronic
935071992 2:99702762-99702784 TTTCTTTAATGCTAAGGTCTGGG + Intronic
935491640 2:103728361-103728383 TATTTTTATTTTTAAGTTCTGGG + Intergenic
936731596 2:115387684-115387706 TGTTTTTATTCATTAGATTTAGG + Intronic
937179742 2:119982818-119982840 CCTTTTTATTCCCAATGTCTTGG + Exonic
937858123 2:126687359-126687381 TGTTTTTCTTCAGTAGGTCTGGG + Intronic
939103907 2:137927174-137927196 TGTTCTTATTCCTCAGCTCAAGG + Intergenic
940782331 2:157945952-157945974 TGCTTCTATTCCTTAGTTCTTGG - Intronic
942125750 2:172823373-172823395 TGTTGTGATTCCAAATGTCTGGG + Intronic
942654373 2:178199450-178199472 TGATTTTATTGCTTAGGTTTGGG + Intronic
944471927 2:200063088-200063110 TGTTTTTCAACCTAAGATCTAGG + Intergenic
944654820 2:201867002-201867024 TGTTGTTATTCCTGGGGTCCTGG + Intronic
945625766 2:212203842-212203864 TTTTTTTATTCCTAGTGTCAGGG - Intronic
945854044 2:215046335-215046357 TGTTTTTTTTTCTTAGGACTTGG + Intronic
946974008 2:225127638-225127660 TGGTGTTATTTCTGAGGTCTTGG + Intergenic
948661182 2:239507393-239507415 TGTTTTTTTACCTAAGCACTTGG - Intergenic
1170341912 20:15338458-15338480 TTTTTTTTCTCCTTAGGTCTGGG + Intronic
1171308839 20:24129484-24129506 AGTTTTTATTCCTATTCTCTAGG - Intergenic
1171893864 20:30742584-30742606 TGTTATTGTTCCTAATATCTGGG + Intergenic
1174691528 20:52511208-52511230 TGTTTTATTTCCTTAGGTTTTGG - Intergenic
1174730428 20:52910800-52910822 TGTTTTAAGTCCCAAGGACTTGG + Intergenic
1174867966 20:54156118-54156140 TGTATTTAGCCCTAGGGTCTAGG - Intronic
1174962942 20:55178337-55178359 TTTTTTTCTTCCTAAAGTGTTGG + Intergenic
1178146556 21:29747046-29747068 TTTCATTATTCCTAAGTTCTTGG - Intronic
1178208981 21:30506020-30506042 TGGTGTTATTTCTGAGGTCTGGG + Intergenic
1178292339 21:31379514-31379536 TTTTTTTTTTCTTAAGGACTGGG - Intronic
1178723110 21:35027508-35027530 TGTATTTATTCCTGAGGCCCTGG + Intronic
1178841395 21:36140410-36140432 TTTTTTTACTCCTTATGTCTGGG + Intronic
1179913782 21:44463551-44463573 TGTTTTTGTTTTTGAGGTCTGGG - Intergenic
1180306250 22:11128393-11128415 AGTTTTTATCCCTAAAGCCTTGG + Intergenic
1180358073 22:11858798-11858820 TGTTATTGTTCCTAATATCTGGG - Intergenic
1180380194 22:12133532-12133554 TGTTATTGTTCCTAATATCTGGG + Intergenic
1180544769 22:16490576-16490598 AGTTTTTATCCCTAAAGCCTTGG + Intergenic
1180670784 22:17551110-17551132 TGCTTTTTTTCCTAAGCTGTTGG + Intronic
1181816377 22:25440037-25440059 TGTTTTTATTGTTGAGTTCTGGG + Intergenic
1182833951 22:33326355-33326377 TTGTATTATTCCTATGGTCTAGG + Intronic
1183778621 22:39984404-39984426 TCTTTTTATTCCTATGGCCCAGG + Intergenic
950943714 3:16922701-16922723 TATTTTTATTACTATGGGCTAGG - Intronic
951352591 3:21624637-21624659 TGGTTTCCTTCCTAAGTTCTAGG - Intronic
952570428 3:34709443-34709465 TGTTTATATTCATAAGGTATTGG - Intergenic
953346820 3:42182829-42182851 CGCTTTTATTTCTAACGTCTTGG - Intronic
953792465 3:45958810-45958832 TGGTTTACTTCCTAAGGTCCTGG + Intronic
955124330 3:56095292-56095314 TCTTTTTATTCATAGGGTATAGG + Intronic
956457246 3:69434514-69434536 TGTTTCTATTCCTGGGTTCTGGG - Intronic
957413675 3:79873323-79873345 TGGTCTTATACATAAGGTCTTGG + Intergenic
957781752 3:84827382-84827404 TGTTTTTAGTATTAATGTCTAGG - Intergenic
958517236 3:95132591-95132613 TGGTTCTAATCCTAATGTCTTGG - Intergenic
960103498 3:113769577-113769599 TCTTTTTATTACCAAAGTCTTGG - Intronic
961400920 3:126642145-126642167 TTATTTTCTTCCTCAGGTCTTGG - Intronic
961959114 3:130835500-130835522 TCTTTTTATGCCTAATGGCTTGG + Intergenic
963048000 3:141117511-141117533 TATTTTTATTTTTAAGTTCTAGG + Intronic
963156660 3:142105559-142105581 TGTTATATTTCCTAAGGGCTGGG + Intronic
964523525 3:157592554-157592576 TGTTTTAATTCCTTTGGTGTAGG + Intronic
965149640 3:164953299-164953321 GGTTTTTTTTCCTTAGCTCTTGG - Intergenic
965468538 3:169062256-169062278 TGTTTTCTTTCCTTGGGTCTTGG - Intergenic
965748224 3:171947784-171947806 TGTTTTTATTTCTATGGGGTTGG + Intergenic
966298561 3:178452596-178452618 TGATTTTTTTCCTAAGGTGATGG + Intronic
967313023 3:188124173-188124195 TCTTTTTATTCTTAAGTCCTGGG + Intergenic
968205200 3:196793577-196793599 TGTTTTTATCCCTATTGTTTTGG - Intronic
968682921 4:1933860-1933882 TGTTTGGATGCCTTAGGTCTTGG + Intronic
969303999 4:6314730-6314752 TGCTTTTGTTCTTAAGGTGTCGG - Intergenic
971385973 4:26140729-26140751 TGTTTTGATTAGTTAGGTCTGGG + Intergenic
972296156 4:37740960-37740982 TGTAGTTATTGATAAGGTCTTGG + Intergenic
972956776 4:44402460-44402482 TGTTTTCATTCTTAAAGTATTGG - Intronic
973688337 4:53398105-53398127 TTTGTTTTTTCCTAAGGTCCAGG + Intronic
973721852 4:53731824-53731846 TGTTTTTCCTCCTGAGGACTGGG - Intronic
973866570 4:55120113-55120135 TGTGTTTTTTCCCAAGGGCTGGG + Intronic
973913966 4:55613937-55613959 TTTTTGTATTCCTAATGTTTTGG - Intronic
974292846 4:59955961-59955983 TGTTTTTATTTCAATGGTTTTGG - Intergenic
974325890 4:60414703-60414725 TGGTGTTATTTCTGAGGTCTTGG + Intergenic
974826679 4:67140088-67140110 TTTTTTTTTTCCTAAGAACTTGG + Intergenic
975303294 4:72817407-72817429 TCTTTATATTCCTAAGGCCTAGG - Intergenic
976449414 4:85170092-85170114 TGTTTTTATTCCTTATTTCCTGG - Intergenic
977036938 4:91965836-91965858 TTTTTTTATTTTTAAGTTCTGGG + Intergenic
977333167 4:95663511-95663533 TGTGTTTTTTCCTAAGTTTTAGG + Intergenic
977492115 4:97728669-97728691 TTTTTTTTTTCCTCAGCTCTGGG - Intronic
977791800 4:101113576-101113598 TGTATTTATTGCTCAGGCCTTGG + Intronic
977950564 4:102965995-102966017 AGTTTTTATCCCTAAAGCCTTGG + Intronic
979398009 4:120211879-120211901 TATTTTTATTCCTGACATCTTGG - Intergenic
979410870 4:120377452-120377474 TGTTTTGCTTCCTCTGGTCTGGG + Intergenic
981304306 4:143230059-143230081 TATTTTTATTTCTTGGGTCTTGG + Intergenic
981624971 4:146744930-146744952 GATTTTTATTCCTAAGATATTGG - Intronic
981921832 4:150093884-150093906 TGAGTTTATTTCTAAGCTCTTGG - Intronic
982325600 4:154125825-154125847 TGTTTTCTTTTCTAAGGTTTTGG + Intergenic
982937455 4:161500128-161500150 TGTTTTTATTCCTAAGGTCTGGG - Exonic
983222546 4:165056471-165056493 TGTTTTTATTACTGAGGCCTTGG + Intergenic
987861067 5:23488870-23488892 TGTTTTTATTTCTATGGGGTTGG + Intergenic
988096120 5:26612549-26612571 TGTTTTAATTACTAAAGTTTGGG + Intergenic
989718676 5:44497267-44497289 TGTCTTTAATGATAAGGTCTGGG + Intergenic
989994780 5:50816492-50816514 TGTGTACATTCCTAAGCTCTAGG - Intronic
990409313 5:55524871-55524893 CCTTTTTATTGCTGAGGTCTTGG - Intronic
991234048 5:64373635-64373657 TATTTTTATTCAGAAGGTGTAGG + Intergenic
991521778 5:67506977-67506999 TGTTTTTATTCCCATTGTTTTGG - Intergenic
992423949 5:76636250-76636272 TGTTTTTAGCTCTCAGGTCTGGG + Intronic
993019313 5:82572319-82572341 TGTTTTTAATCCAATGGTCATGG - Intergenic
993060327 5:83030551-83030573 TGTTTTTATTCTCTAGGTCTTGG + Intergenic
993399489 5:87431200-87431222 TGTTATTACTCATAAGGTCATGG + Intergenic
994843359 5:104953317-104953339 TCTTTGTATTTCCAAGGTCTAGG - Intergenic
995637279 5:114208078-114208100 TGTTTTAATTCCTGAGCTCATGG - Intergenic
995847136 5:116505828-116505850 TGTTTTTATTTCCAAGATTTAGG - Intronic
995869062 5:116725130-116725152 GTTTTTTCTTCCTCAGGTCTTGG + Intergenic
995950221 5:117703362-117703384 TGTTTTAAATCCTAAGGCATTGG - Intergenic
996685655 5:126277874-126277896 TGTTTTTTTTTTTAAAGTCTGGG - Intergenic
997180700 5:131825701-131825723 TGTCTGTATGCCTGAGGTCTTGG - Intronic
997217428 5:132124875-132124897 TGTTGTTTTTGCTTAGGTCTTGG + Intergenic
997918914 5:137958439-137958461 TGTTTTTTTTTTTAAGGTCTAGG - Intronic
998128906 5:139641314-139641336 GGTTTTTTTTCCTCAGGCCTAGG - Intergenic
998717985 5:144907701-144907723 TTTTTTTATCCTTAAAGTCTGGG - Intergenic
999888204 5:155947352-155947374 TTTTTTTATTATTAAGATCTTGG + Intronic
1000125694 5:158241557-158241579 TGTTTTAATTCCTAAGCTTCTGG + Intergenic
1000555778 5:162724280-162724302 TTTTTTTATACTTAAGCTCTGGG + Intergenic
1001025383 5:168219919-168219941 TGTTTGTATGCCAATGGTCTTGG + Intronic
1001312476 5:170621206-170621228 TGTTTCTATGCCTAATGTCTTGG - Intronic
1003728168 6:8790263-8790285 TGTTTTTAGTCCTAAGTTAGTGG + Intergenic
1006622299 6:35374271-35374293 TGGGTTTATTGCTAAGGTCATGG + Intronic
1007367550 6:41405710-41405732 TATTTTTATTCCTAAGGTTTGGG + Intergenic
1007832855 6:44652140-44652162 TCTTTTTATTTCTAAGTTTTAGG - Intergenic
1007855466 6:44851259-44851281 TCTTTTTATTCCTTAGATATTGG - Intronic
1008375664 6:50788204-50788226 TGTTTATATTTCTGAGGGCTGGG - Intergenic
1009362984 6:62837193-62837215 TGATTTTGTTCCTAATGTCGAGG + Intergenic
1010593738 6:77739714-77739736 TTTTTTTAATTCTAAGTTCTGGG - Intronic
1011819523 6:91235142-91235164 TGTTTTTAGTCCTAAGACTTTGG - Intergenic
1013485974 6:110596480-110596502 TGTTTTTATTCCTTAGCCTTGGG + Intergenic
1014286072 6:119499661-119499683 TCTTTTTATTACTAAGTTGTAGG + Intergenic
1015376013 6:132511502-132511524 TGTTTGTATTCCAGAGGTGTAGG - Intronic
1015575193 6:134663841-134663863 TGTTTTTATTTCTATTGTTTTGG + Intergenic
1016713071 6:147195540-147195562 TCTTTTTCTTCCTATAGTCTTGG + Intergenic
1017492602 6:154957536-154957558 TGATTTTATTCCTAGGATATAGG + Intronic
1017891807 6:158644974-158644996 TGTTTCTGTTGCTAAGGTTTAGG - Intergenic
1018223557 6:161606097-161606119 TTTTTCTATCCCAAAGGTCTGGG + Intronic
1020440167 7:8209054-8209076 GGCTTTTCTTCCTAAGGTTTAGG - Intronic
1020694533 7:11397238-11397260 TGTTATTATTTCTGAGGCCTCGG - Intronic
1020994454 7:15245294-15245316 TGTTGTTTTCCCTGAGGTCTGGG + Intronic
1021079962 7:16352390-16352412 TGTATTTATTTTTAAGTTCTGGG - Intronic
1023210441 7:37798261-37798283 TGTTTTAAGTCCTCATGTCTTGG + Intronic
1023377816 7:39576372-39576394 TGTTTTTGTTTTTCAGGTCTTGG + Intronic
1023569736 7:41559518-41559540 TGCTTCTATTCTTAAGGTATTGG + Intergenic
1024201696 7:47115023-47115045 GGTTTTTACCCTTAAGGTCTGGG - Intergenic
1026893512 7:73996926-73996948 TCTTTGTTTTCCTAAGGACTGGG - Intergenic
1027398614 7:77784797-77784819 TGTGTTTCTTCCTAAGTTCTTGG + Intergenic
1030166577 7:106561676-106561698 TATTTTTATTCAGCAGGTCTGGG - Intergenic
1030879425 7:114858761-114858783 GATTCTTATTCCAAAGGTCTGGG - Intergenic
1031183958 7:118452371-118452393 TTTCTTTGTTCCTAAGGTTTAGG + Intergenic
1031391247 7:121217587-121217609 TGTTTTTATTCTTAAAGTTTTGG + Intronic
1032040474 7:128556009-128556031 TTTCTTTTTTCCTAATGTCTTGG - Intergenic
1035794896 8:2346438-2346460 TGTCTTTATTCCTTACATCTGGG + Intergenic
1037031034 8:14105886-14105908 TTTTTTTATTTCTAACGTTTTGG - Intronic
1038833179 8:31086169-31086191 TTTTTTTATTCCTAATCTTTAGG + Intronic
1039922852 8:41905377-41905399 GGTTTTTTTTTCTAAGCTCTGGG - Intergenic
1040718405 8:50287339-50287361 TGTTTTTATTCATAAAGACAAGG - Intronic
1040887417 8:52280487-52280509 GCTTTTTGTTCTTAAGGTCTAGG - Intronic
1042885859 8:73550356-73550378 TGTTTTTATTTCTAAGCTCTTGG - Intronic
1043557135 8:81444299-81444321 TTTTTTTATTTCTAAAATCTTGG + Intronic
1043680381 8:83017951-83017973 TGCTTTTCTTCCTAAGGTCTTGG + Intergenic
1043809243 8:84715360-84715382 TGATTTTATTTCTAATCTCTAGG + Intronic
1044215868 8:89609609-89609631 TATTTTTAGTTCTAATGTCTGGG + Intergenic
1044218198 8:89637730-89637752 TATTTTTAGTTCTAATGTCTAGG - Intergenic
1044605022 8:94040886-94040908 TGTTTTTCTTCCTAGATTCTGGG - Intergenic
1045768298 8:105703514-105703536 TGTTTTTTTTAATAAGGTCTTGG + Intronic
1047662095 8:127048214-127048236 TCTTTTTATTATTAAGTTCTGGG - Intergenic
1047859757 8:128952781-128952803 TGTTTTTCTTCCTCATGTTTAGG - Intergenic
1048095176 8:131284296-131284318 TGTTATTATTGCTTAGGTATAGG - Intergenic
1048461370 8:134624239-134624261 TGTTTTTCTTAGTAAGGTGTGGG - Intronic
1048770170 8:137886644-137886666 TGTTTTGATTCATAAGGATTTGG - Intergenic
1049475068 8:142793500-142793522 TTCTTTCATTCCTAAGGGCTAGG - Intergenic
1049956272 9:695973-695995 TGTTTGTATTCCTCAGTACTTGG - Intronic
1050681294 9:8114805-8114827 TGATTTTATTCCCTAGGTCAGGG - Intergenic
1051130889 9:13859488-13859510 TGTTTTTATTGTGAATGTCTTGG + Intergenic
1051157391 9:14165223-14165245 TGTCTTATTTCCTAAGGCCTGGG - Intronic
1052854225 9:33397142-33397164 GGTTTTTCTTCCTAAGGGCTGGG + Intronic
1053179390 9:35955573-35955595 TGTTTTTTTACCTAAGGGTTTGG - Intergenic
1053682236 9:40493303-40493325 GGTTTTTCTTCCTAAGGGCTGGG + Intergenic
1053932220 9:43121630-43121652 GGTTTTTCTTCCTAAGGGCTGGG + Intergenic
1054281478 9:63131626-63131648 GGTTTTTCTTCCTAAGGGCTGGG - Intergenic
1054295334 9:63328803-63328825 GGTTTTTCTTCCTAAGGGCTGGG + Intergenic
1054393352 9:64633307-64633329 GGTTTTTCTTCCTAAGGGCTGGG + Intergenic
1054428001 9:65138521-65138543 GGTTTTTCTTCCTAAGGGCTGGG + Intergenic
1054502377 9:65883023-65883045 GGTTTTTCTTCCTAAGGGCTGGG - Intronic
1054986191 9:71264232-71264254 CGTTTTTCTTCCTCAGCTCTTGG - Intronic
1055172280 9:73273434-73273456 TGTGTCAATTTCTAAGGTCTTGG + Intergenic
1055418415 9:76109229-76109251 TGTTTTTATTCTGAAATTCTAGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057531002 9:95846640-95846662 TATTTTAATTCATTAGGTCTGGG - Intergenic
1058006618 9:99922870-99922892 AGTTGTTCTTCCCAAGGTCTGGG + Intronic
1058369955 9:104254992-104255014 GGTTTTTTTTCCTAATGGCTGGG - Intergenic
1059068933 9:111115045-111115067 TGGCTTTATTCGTAAGGTTTTGG - Intergenic
1188865310 X:35306382-35306404 AGTTTGTGTTCCCAAGGTCTTGG - Intergenic
1189362433 X:40363137-40363159 TGTTTGTATGCCTGAGGTCTGGG - Intergenic
1190279999 X:48923209-48923231 TGTTTTTCTTCATACTGTCTAGG + Exonic
1190452445 X:50595291-50595313 TGTTTGTATGCCTAAGATCCTGG + Exonic
1192984813 X:76385805-76385827 TTTTTTTATACTTAAGTTCTGGG - Intergenic
1196006606 X:110843653-110843675 TGTTTTTATGCCTAACATTTGGG + Intergenic
1196329651 X:114456600-114456622 TGTTTTGTTTCCTAAGGGCACGG + Intergenic
1196394475 X:115244459-115244481 TGTTATTATTTTTAAGTTCTGGG - Intergenic
1198720095 X:139608205-139608227 TTTTTTTTTTTCTAAGATCTGGG + Intronic
1199249736 X:145646806-145646828 GGTATTTTTTTCTAAGGTCTGGG - Intergenic
1199811776 X:151356854-151356876 TTTTTTTTTTCATAAGTTCTGGG - Intergenic
1200368050 X:155688692-155688714 TGTTTTTTTTTTTAAGTTCTGGG + Intergenic
1200391076 X:155947891-155947913 TGTTTTATTTCCTAAGGTTCAGG + Intergenic