ID: 982937456

View in Genome Browser
Species Human (GRCh38)
Location 4:161500129-161500151
Sequence GTGTTTTTATTCCTAAGGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982937456 Original CRISPR GTGTTTTTATTCCTAAGGTC TGG (reversed) Exonic
901646833 1:10721280-10721302 GTTTTTTTTTCCCTAAGATCAGG - Intronic
901797398 1:11688253-11688275 GTGTGCTGATTCCTAAGGTTGGG - Intronic
905024566 1:34840825-34840847 GTGTCTGTACTCCTAAGCTCTGG - Intronic
907179505 1:52557298-52557320 CTGATGTTATTCCTAAGGTCAGG - Intergenic
908815267 1:68025347-68025369 CTTTTTTTTTTCCTAAGCTCTGG + Intergenic
909895498 1:81064097-81064119 GCATTTTTATTCCTAAGTTATGG - Intergenic
910705190 1:90122246-90122268 GTGTTTTTATTTGTGAGGTCTGG - Intergenic
912685497 1:111759268-111759290 GAGTTTTTATTGATAAGGTAAGG - Intronic
912757539 1:112336945-112336967 ATCTGTTTATTCCTTAGGTCGGG - Intergenic
912919153 1:113848690-113848712 GTGTTCATATTCCTAAAATCTGG - Intronic
914704326 1:150159015-150159037 GTCTGTTTTTTCCCAAGGTCGGG - Exonic
916698523 1:167265886-167265908 GAGTTTTAATACCTAAGGTAGGG - Intronic
916985333 1:170185222-170185244 GTGTTTTTTTTTTTAAGTTCAGG + Intergenic
918735461 1:188056832-188056854 GTTATTTTTCTCCTAAGGTCAGG - Intergenic
920077180 1:203345936-203345958 GTCTTTTTATTCCCAAGGTGGGG - Intronic
923197278 1:231680613-231680635 ATGGTTTTATTTTTAAGGTCAGG + Intronic
1064954216 10:20889839-20889861 GTGCTTTTATTTCTGAGGTAAGG - Exonic
1066553440 10:36584870-36584892 CTATTTTTGTTTCTAAGGTCTGG - Intergenic
1068849301 10:61718292-61718314 GTGTTTTAATTTCCAAAGTCAGG + Intronic
1070869346 10:79736368-79736390 GTGATTATTTTCCTAAGATCTGG + Intergenic
1071177949 10:82948983-82949005 ATGTTTTTTTCCCTAAGATCAGG - Intronic
1071361719 10:84852763-84852785 GTGTCTTTTTTCCTAGGGTAGGG - Intergenic
1071636265 10:87258569-87258591 GTGATTATTTTCCTAAGATCTGG + Intergenic
1071658976 10:87479382-87479404 GTGATTATTTTCCTAAGATCTGG - Intergenic
1072456438 10:95580392-95580414 GTGCTTTTATTTTTAAGGGCTGG - Intergenic
1072747781 10:97953525-97953547 GTGTTTTGAGTCCCAAGGTCAGG - Intronic
1073091939 10:100948963-100948985 TTGTTTTAATTCCTAGGATCTGG - Intronic
1075565165 10:123497879-123497901 GTGTTTTTATTTGCTAGGTCTGG - Intergenic
1076221174 10:128734304-128734326 GTGTTTTTATTCTGATGGTAAGG + Intergenic
1077634427 11:3832519-3832541 GTGTATTCATTCCCATGGTCAGG - Intronic
1080208543 11:29757882-29757904 ATGTTTTCATTCCTAAAGTAGGG + Intergenic
1081648198 11:44804698-44804720 GTGTGTTTATCTTTAAGGTCTGG + Intronic
1082165381 11:48944065-48944087 GTGTTTTGATTTCTAAGCTAGGG - Intergenic
1082169320 11:48983272-48983294 GTGTTTTGATTTCTAAGCTAGGG + Intergenic
1082611206 11:55299848-55299870 GTGTTTTGATTTCTAAGCTAAGG + Intergenic
1082658721 11:55883845-55883867 GTGTTTTGATTTCTAAGCTAGGG - Intronic
1082719719 11:56659015-56659037 GTTTTTTAATTTTTAAGGTCAGG + Intergenic
1082765238 11:57162586-57162608 GTGTTCTTATTGATCAGGTCTGG + Intergenic
1083472640 11:62894384-62894406 ATGTTTTGATTCAGAAGGTCTGG + Intergenic
1086696509 11:89853375-89853397 GTGTTTTGATTTCTAAGCTAGGG - Intergenic
1086709649 11:89991115-89991137 GTGTTTTGATTTCTAAGCTAGGG + Intergenic
1087145358 11:94805413-94805435 GTGCTTTCATTCCTAGGGTGAGG + Intronic
1087287448 11:96280507-96280529 TTGTATTTTTTCCTGAGGTCAGG + Intronic
1088052472 11:105534149-105534171 GTGTTTTATTTCCTAAGACCTGG - Intergenic
1088389129 11:109294336-109294358 GAGTTTTTAATCCTAAGGAAAGG + Intergenic
1089065886 11:115661712-115661734 TTGTTTCTTTTCCTATGGTCTGG - Intergenic
1089991035 11:122860220-122860242 GTGTTTTTATTAGTAGAGTCAGG + Intronic
1090641765 11:128735433-128735455 GGCTTTTTATTTCTAAGGTTTGG + Intronic
1090780909 11:130005300-130005322 GAGTTTTTATTCAGAGGGTCTGG + Intergenic
1091474168 12:754715-754737 GTGTTTTCATTCCTGAGATCAGG + Intronic
1092082160 12:5725276-5725298 GTGTATTTATTCATTATGTCAGG + Intronic
1093337458 12:17923506-17923528 GTGTTTTTATGGGTAAGGTGAGG - Intergenic
1095233758 12:39772978-39773000 GTGTTTATATTTTGAAGGTCAGG - Intronic
1097433987 12:59538696-59538718 GTGATATTGTTCCTAATGTCCGG + Intergenic
1098095303 12:66948110-66948132 ATGTGTTTATTCCCAAGGCCAGG + Intergenic
1098864237 12:75743781-75743803 GTGTTTTTTTGCCAAAGGTTTGG - Intergenic
1099181375 12:79475171-79475193 GTGATATTGTTCCTAATGTCCGG + Intergenic
1101644807 12:106621430-106621452 TGGTTTTTATTCCTAAAGCCTGG + Intronic
1107734836 13:43388023-43388045 GTGTTTTTATTAGTAACCTCCGG - Intronic
1109760509 13:66821684-66821706 GTATTTTTATTCTTAAGTTGGGG - Intronic
1110255311 13:73427163-73427185 TTGTTATTGTTCCTAAGCTCTGG + Intergenic
1113393341 13:109918926-109918948 GTGTTTTTATTGCTAAATTAGGG + Intergenic
1114044556 14:18712360-18712382 GTTTTTTGACTCCTAAGGACAGG - Intergenic
1114048889 14:18903086-18903108 GTTTTTTGACTCCTAAGGACAGG - Intergenic
1114113673 14:19498847-19498869 GTTTTTTGACTCCTAAGGACAGG + Intergenic
1114115372 14:19616596-19616618 GTTTTTTGACTCCTAAGGACAGG + Intergenic
1115877012 14:37872203-37872225 GTGTTGTTATTCCTATTGTCAGG - Intronic
1116082067 14:40186761-40186783 GTGTTTTTACTACTAAGTTGTGG + Intergenic
1118368413 14:65115266-65115288 ATGTGTTTATGCCTAAGGCCAGG - Intergenic
1118940146 14:70326898-70326920 GTCTTTTCATTCCTAAGCCCAGG - Intronic
1120436017 14:84483517-84483539 ATGTTTTTATTGGAAAGGTCTGG - Intergenic
1123797131 15:23783393-23783415 ATTTTTTTCTTCCTAAGGTAAGG + Intergenic
1126242161 15:46457596-46457618 ATGTTTTGATTCCTAATGCCTGG + Intergenic
1128285301 15:66431695-66431717 TTGTTTTTATTTTTAAGTTCAGG + Intronic
1132839836 16:1973656-1973678 GTGTCTTCATCCCTGAGGTCTGG - Intronic
1132979756 16:2731048-2731070 GTGTTTATATTACTAAATTCAGG - Intergenic
1133910034 16:10057259-10057281 TTGTATTTATTCTTGAGGTCTGG - Intronic
1133991170 16:10708675-10708697 GTGTTATTCTTCCTAATATCCGG - Intergenic
1134282759 16:12832375-12832397 GTGTTGTTATTCCCAGGGACTGG - Intergenic
1135424816 16:22327160-22327182 ATGTTTTCATTGCCAAGGTCAGG + Intronic
1139146687 16:64333421-64333443 TTTTTTTTTTGCCTAAGGTCAGG + Intergenic
1141150239 16:81559439-81559461 GTTTTCATATTCCTAAGTTCAGG + Intronic
1146533035 17:33626912-33626934 GTGTTTTTATTCTGAAGGTGAGG - Intronic
1147599796 17:41738690-41738712 GTGTTTTTTTTCCCAGGGTCAGG - Intergenic
1149370704 17:55991248-55991270 GTGTTCTGATTCCTCAGGACAGG - Intergenic
1150342250 17:64377909-64377931 GTTATTTTATTCCTGAAGTCCGG - Exonic
1150364137 17:64566491-64566513 GTTTTTTTCTTCTTAAGGACAGG - Intronic
1153142786 18:1994082-1994104 GTGTTTTAATTCCAAGGGTCTGG - Intergenic
1155955504 18:31953435-31953457 TTTTTTTTATTTTTAAGGTCTGG - Intergenic
1157202648 18:45672131-45672153 GTGATTTTGTTAGTAAGGTCTGG - Intronic
1158252483 18:55505116-55505138 GTGTTTTGCTTCCATAGGTCAGG - Intronic
1158268763 18:55689337-55689359 GTTTTTGTATTCCTTAGGTAAGG - Intergenic
1158979619 18:62747217-62747239 TTCATTTTATTCCTAAGGTCAGG + Intronic
1159973740 18:74685149-74685171 TTGTTTTTATTATAAAGGTCAGG + Intronic
1162436111 19:10660219-10660241 CTTTTTTTTTTCCTAAGGACTGG + Intronic
1164377555 19:27701841-27701863 GTGTTTTTATTCACCAGGTTGGG - Intergenic
1164391238 19:27822926-27822948 ATCTTTTTATCCCTCAGGTCAGG - Intergenic
1168318664 19:55495574-55495596 GTGTTATTATTACTGAGGTATGG + Intronic
926876059 2:17480442-17480464 GTTTTTTTATTCATTAGGTTTGG - Intergenic
926973413 2:18489289-18489311 GTTTTTTTCTTCCTCTGGTCAGG - Intergenic
928175554 2:29031693-29031715 GTATTTTTCTTCCTTAGGTCAGG - Intronic
928360505 2:30658743-30658765 GGGTTTTTTTTCCTATGGTATGG - Intergenic
929579122 2:43070650-43070672 GTGCTTTTCTTCCTACAGTCTGG + Intergenic
930309381 2:49719083-49719105 ATATTTGTATTGCTAAGGTCTGG + Intergenic
930632849 2:53772702-53772724 GTGTTTTTGTTTTTAAGTTCAGG + Intronic
934475829 2:94592776-94592798 CAGTTTTTCTTCCTAAGGGCTGG - Intronic
934592880 2:95573226-95573248 GTGTTTTGATTTCTAAGCTAGGG - Intergenic
935071991 2:99702761-99702783 GTTTCTTTAATGCTAAGGTCTGG + Intronic
936502739 2:113079057-113079079 GAGCTTTTATTCACAAGGTCTGG - Intergenic
937801135 2:126081548-126081570 ATCTTTTTATACCTAAGGTGTGG - Intergenic
937858122 2:126687358-126687380 GTGTTTTTCTTCAGTAGGTCTGG + Intronic
938426204 2:131191342-131191364 GTTTTTTGACTCCTAAGGACAGG - Intronic
941088438 2:161146546-161146568 TTGTTTTTCTTTCAAAGGTCAGG + Intronic
942125749 2:172823372-172823394 GTGTTGTGATTCCAAATGTCTGG + Intronic
942178546 2:173357116-173357138 GTGTTTTTATTCCTTAAATGGGG - Intronic
942317139 2:174706904-174706926 GTGATATTATTTCTAACGTCGGG - Intergenic
942646808 2:178120534-178120556 GTTTTTTTATTCCTAAAATGTGG + Intronic
943249643 2:185501327-185501349 TTGTTTTTATTTTTAAGTTCTGG - Intergenic
945625767 2:212203843-212203865 TTTTTTTTATTCCTAGTGTCAGG - Intronic
947272377 2:228351636-228351658 GCGTGGTTATTTCTAAGGTCAGG - Intergenic
947675732 2:231977873-231977895 TTGTTTTTATTCTTGAGTTCTGG + Intronic
1169900492 20:10547700-10547722 GTGTTTTTTTTCCTGCGTTCAGG + Intronic
1171240936 20:23566504-23566526 ATTTTTTTTTTCCTCAGGTCAGG - Intronic
1171893863 20:30742583-30742605 GTGTTATTGTTCCTAATATCTGG + Intergenic
1178008455 21:28253037-28253059 GTGTTTTTATTTGTTAAGTCTGG + Intergenic
1178208980 21:30506019-30506041 GTGGTGTTATTTCTGAGGTCTGG + Intergenic
1180358074 22:11858799-11858821 GTGTTATTGTTCCTAATATCTGG - Intergenic
1180380193 22:12133531-12133553 GTGTTATTGTTCCTAATATCTGG + Intergenic
1180467376 22:15625471-15625493 GTTTTTTGACTCCTAAGGACAGG - Intergenic
1181322538 22:22019444-22019466 AAGTTGTTATTCCTAAGATCAGG - Intergenic
1184364175 22:44038899-44038921 GTGTTTTTATTCTTGAGTTGCGG - Intronic
1185076013 22:48682814-48682836 GTGTGTTTATTTCTAAAGCCAGG + Intronic
951435209 3:22654927-22654949 GTGTTTTTATAGGTAAGGTATGG + Intergenic
951525987 3:23653359-23653381 GGGTTTTAATTCCTAATCTCTGG - Intergenic
952062611 3:29528550-29528572 TTGATAATATTCCTAAGGTCAGG - Intronic
952246627 3:31600588-31600610 CTGTTTATATTGATAAGGTCAGG + Intronic
957680116 3:83423132-83423154 GTGTATCTATTCCTAGTGTCTGG + Intergenic
959195288 3:103172667-103172689 GTGTTTTCATTTTTAATGTCTGG + Intergenic
959492323 3:107005252-107005274 TTGTTTTTATTCATGAGGTTTGG + Intergenic
960009863 3:112822069-112822091 ATTTTTGTATTCCTAAAGTCTGG - Intronic
960048656 3:113220664-113220686 CTGTTTTTATTTCTCAGGGCAGG + Intronic
963858848 3:150285699-150285721 GTATTTTTCTTCCTGTGGTCTGG + Intergenic
964454429 3:156846391-156846413 GTGTTTTTCCCCCTAAGGTTGGG - Intronic
964624363 3:158745203-158745225 GTGTTCTTATTCCACAGGGCAGG + Intronic
967937190 3:194738620-194738642 GTGTTTCTATTCCCAGGGCCTGG - Intergenic
970831932 4:20350044-20350066 GTGATTTTTATCCTAAGCTCTGG + Intronic
971385972 4:26140728-26140750 GTGTTTTGATTAGTTAGGTCTGG + Intergenic
975002808 4:69245977-69245999 TTCTTTTTTTTCCTAAGATCTGG - Intergenic
975010911 4:69349963-69349985 TTCTTTTTTTTCCTAAGATCTGG - Intronic
979002018 4:115233542-115233564 CTGTTTTTACTCCAAGGGTCAGG + Intergenic
980864948 4:138543115-138543137 TTGTTTTTCTTTCAAAGGTCAGG - Intergenic
982334083 4:154214519-154214541 GTGTTTTGATACCCAAGGGCAGG + Intergenic
982937456 4:161500129-161500151 GTGTTTTTATTCCTAAGGTCTGG - Exonic
983504527 4:168538685-168538707 ACGTTTTTTCTCCTAAGGTCTGG - Intronic
985419627 4:189771420-189771442 GTGTTCTTATTTCTAAATTCAGG + Intergenic
985774879 5:1835953-1835975 ATGTTTTTAATCCTAACATCTGG - Intergenic
987156882 5:15097230-15097252 GTGTCTTCATTTCTAAGGGCTGG + Intergenic
988201948 5:28079211-28079233 GCTTTTTTATCCCTAAAGTCAGG + Intergenic
990892394 5:60663106-60663128 GTGTTTCTTTTCCTATGTTCAGG - Intronic
991468074 5:66935970-66935992 CAGTCTTTAATCCTAAGGTCAGG + Intronic
992661991 5:78971072-78971094 AAGTTTTTATTCCTTAGGTCTGG - Intronic
995560743 5:113378576-113378598 TTGTTTTTCTTCCTTTGGTCAGG - Intronic
996572801 5:124950633-124950655 GCTTTTTTATTACTAAAGTCGGG + Intergenic
996583859 5:125062960-125062982 TTGGTTTTATTCCTCAGGGCAGG + Intergenic
997684261 5:135777764-135777786 GTGATATTATTCCTAATATCCGG + Intergenic
998719526 5:144928255-144928277 GTGATTATATTCCTCAGTTCTGG - Intergenic
999075368 5:148790668-148790690 GTGTTTTTAATACTGAGGTGGGG - Intergenic
999506127 5:152198405-152198427 TTTTTTTTATTCCTAAGGCACGG - Intergenic
1005093791 6:22088318-22088340 TTATTTTTCTTCCTAAGCTCAGG + Intergenic
1007273765 6:40658538-40658560 GTGATTTGACTCCTAAGGACAGG - Intergenic
1007367549 6:41405709-41405731 TTATTTTTATTCCTAAGGTTTGG + Intergenic
1007862788 6:44930665-44930687 GTGTTATTATTCCTCAGGAGGGG - Intronic
1008115473 6:47544880-47544902 GCATTTTTATTCCTAAAGGCAGG - Intronic
1010063733 6:71655792-71655814 TTCTTTCTATTCCTAAAGTCAGG - Intergenic
1010108626 6:72197716-72197738 TTGTTTTAATGCCTAAGATCAGG - Intronic
1010286749 6:74086933-74086955 GGGTTTTTATACTTAAGATCAGG - Intergenic
1011465980 6:87657752-87657774 TTCTTTTTATTTTTAAGGTCTGG - Intronic
1013016991 6:106168883-106168905 GTTTTTCTATTCCTGAGGTCTGG + Intergenic
1017579488 6:155847478-155847500 GTGTTTTTATGTCTAAGAACTGG - Intergenic
1018223556 6:161606096-161606118 GTTTTTCTATCCCAAAGGTCTGG + Intronic
1018331448 6:162732119-162732141 GTGTATTTATTACTAGGTTCTGG - Intronic
1021812714 7:24418936-24418958 GTATTTTTAATTCTAAGATCAGG + Intergenic
1022351571 7:29571156-29571178 GTGTCTTTATTTCTGAGGTGTGG + Intergenic
1022786717 7:33645376-33645398 GTGTTTTTTTCCCTAAAGACTGG + Intergenic
1024201697 7:47115024-47115046 GGGTTTTTACCCTTAAGGTCTGG - Intergenic
1027390552 7:77699249-77699271 GTGTCTTTATAGCTAATGTCTGG - Intronic
1027529989 7:79318168-79318190 GTGATTTTATGTCAAAGGTCTGG - Intronic
1027833337 7:83209025-83209047 ATGTTTTTGTTCTTCAGGTCTGG - Intergenic
1028193484 7:87877802-87877824 GTGTGTTTATTCCTGAGGCACGG - Intronic
1029893127 7:103952741-103952763 CTGTTTATATTCAAAAGGTCGGG + Intronic
1030319796 7:108153425-108153447 GTATTTTTATTCCTAACATTAGG + Intronic
1031657523 7:124376499-124376521 CTATTTTAATTCCTAATGTCTGG - Intergenic
1032896561 7:136257237-136257259 GTGATTTTATTGCTAAGTCCAGG + Intergenic
1039266448 8:35829390-35829412 GTGTTTATATTACTAGTGTCAGG - Intergenic
1039607606 8:38895363-38895385 GTGTCTTTATTGCTAAGCTAAGG - Intergenic
1040681100 8:49810351-49810373 TTTTTTTTTTTTCTAAGGTCAGG + Intergenic
1043022381 8:75019990-75020012 GTGTTTTAATTCTTCAGTTCAGG + Exonic
1043047075 8:75339655-75339677 ATCATTTTATTCCTAAGATCAGG - Intergenic
1043789051 8:84439701-84439723 GTGTTTTAATTACTAAAATCAGG - Intronic
1044881460 8:96727425-96727447 GTGTTTTTATACCTTATGTCAGG - Intronic
1045926930 8:107585673-107585695 GTGTTATTGTTCCTAATATCCGG - Intergenic
1050320009 9:4442476-4442498 GTGTTTTCACTCCCAAGTTCTGG - Intergenic
1050681295 9:8114806-8114828 ATGATTTTATTCCCTAGGTCAGG - Intergenic
1051003529 9:12314764-12314786 TTGTTTTTCTTCCAACGGTCTGG + Intergenic
1051095404 9:13460326-13460348 GAGTCTCAATTCCTAAGGTCAGG - Intergenic
1052253347 9:26425693-26425715 GTGTTCTTATTCCTATGTTTAGG - Intergenic
1052854224 9:33397141-33397163 CGGTTTTTCTTCCTAAGGGCTGG + Intronic
1053682235 9:40493302-40493324 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1053932219 9:43121629-43121651 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054281479 9:63131627-63131649 CGGTTTTTCTTCCTAAGGGCTGG - Intergenic
1054295333 9:63328802-63328824 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054393351 9:64633306-64633328 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054428000 9:65138520-65138542 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054502378 9:65883024-65883046 CGGTTTTTCTTCCTAAGGGCTGG - Intronic
1055190414 9:73514328-73514350 GGATTTTTATTCATTAGGTCAGG - Intergenic
1056393848 9:86163707-86163729 GTGGTTCTGTTACTAAGGTCGGG + Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1057531003 9:95846641-95846663 GTATTTTAATTCATTAGGTCTGG - Intergenic
1062618548 9:137408898-137408920 CTGTTTTTATCCCTGAGCTCAGG + Intronic
1186078042 X:5901991-5902013 TTGTTTTCATTCCTATGGCCAGG + Intronic
1186215156 X:7291998-7292020 GTTTTTTTCTTCCTAAAGTATGG - Intronic
1186453440 X:9692096-9692118 GTGTTTTTATTCTGTAGATCTGG + Exonic
1189362434 X:40363138-40363160 CTGTTTGTATGCCTGAGGTCTGG - Intergenic
1194318277 X:92409609-92409631 ATGTTTTTCTTCCCTAGGTCTGG + Intronic
1197421651 X:126242651-126242673 GTGTTTTTATTTTTAATGCCCGG - Intergenic
1199249737 X:145646807-145646829 GGGTATTTTTTTCTAAGGTCTGG - Intergenic
1199591298 X:149470460-149470482 GTGTTTTTATCCGTAAAATCTGG - Intergenic
1200404127 Y:2791244-2791266 GTTTTTTTAATCTTAAGGTATGG + Intergenic
1200626445 Y:5522900-5522922 ATGTTTTTCTTCCCTAGGTCTGG + Intronic
1200764707 Y:7070703-7070725 GTGTTTTTATTCTGTAGATCTGG + Exonic
1201517261 Y:14831407-14831429 TTGTTTGTATTCATATGGTCAGG - Intronic