ID: 982944689

View in Genome Browser
Species Human (GRCh38)
Location 4:161605283-161605305
Sequence CTGTGGAAGGCTATGTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982944689 Original CRISPR CTGTGGAAGGCTATGTGCTA TGG (reversed) Intronic
901322120 1:8346208-8346230 CTGAGGAAGGCTATGGCCCATGG - Intergenic
903358082 1:22760334-22760356 CTGGGGAAGACTGTGGGCTAAGG + Intronic
903375353 1:22862363-22862385 CTGTGCAAGGCCTTGTGCCATGG + Intronic
903553925 1:24179750-24179772 CTGTGCCAGGCCAAGTGCTAAGG - Intronic
903620188 1:24692526-24692548 CTGGGGAAAGCTAGCTGCTATGG - Intergenic
903899170 1:26630707-26630729 GTGGGGAAGGCTAGGAGCTAGGG - Intergenic
905005589 1:34707181-34707203 CTGAGGAAGGCTGTGTTCCATGG - Intergenic
906695588 1:47821229-47821251 CTGTATAAGGCTCTGTGCTATGG + Intronic
909737048 1:78974714-78974736 AAGTGGAAGGCCATGAGCTAAGG - Intronic
910111889 1:83692279-83692301 CAGCAGAAGGCTATGTCCTAAGG - Intergenic
916537667 1:165719047-165719069 CTGTGCAAGACCCTGTGCTACGG - Intergenic
920447511 1:206030006-206030028 CTGTGCTAGGCTCTGAGCTAAGG + Intergenic
920742471 1:208594545-208594567 CTGTGCAAGGCAGTGTGCTAGGG + Intergenic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
1063049381 10:2430224-2430246 CTGTGGGAGGCTGTGTGATTGGG - Intergenic
1065388743 10:25160130-25160152 CTGTGGAAAGTTCTGTGCTCTGG - Intergenic
1065705796 10:28470558-28470580 CTGTGCCAGGCTGTGTTCTAAGG - Intergenic
1067489341 10:46683730-46683752 CTGTCTAAGGCTCTGTTCTAAGG - Intergenic
1067605329 10:47656655-47656677 CTGTCTAAGGCTCTGTTCTAAGG + Intergenic
1067704819 10:48598819-48598841 TTGTGAAAGCCTCTGTGCTAAGG - Intronic
1068966320 10:62915471-62915493 CTGTGGTAGGCTTTGTTCAATGG - Intronic
1070532243 10:77347166-77347188 CTGTATCAGGCTCTGTGCTAGGG - Intronic
1071570380 10:86693386-86693408 CTGTGGCAGCCTCTGTGCAAGGG + Intronic
1071620890 10:87118051-87118073 CTGTCTAAGGCTCTGTTCTAAGG + Intronic
1072210994 10:93246941-93246963 CTGTGGGAGGCCATGTGCAAGGG + Intergenic
1072213010 10:93264115-93264137 CTGTGTCAGGCATTGTGCTATGG - Intergenic
1072783692 10:98266821-98266843 TTGTGGAAGGCTTTGTGGGAGGG - Intronic
1074987849 10:118673166-118673188 CTGTGCCAGGCCATGTGTTATGG + Intergenic
1075194250 10:120341316-120341338 CTGCAGAAGGCAATGTGTTAGGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077600889 11:3573717-3573739 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1077605792 11:3610846-3610868 TTGTGCCAGGCTCTGTGCTAGGG + Intergenic
1077833304 11:5899655-5899677 CTGTGGTAGGCTCTGGGCCATGG - Intronic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1080791716 11:35527350-35527372 ATGTGGTAGGCTCTGTGCTATGG - Intronic
1085717164 11:78882465-78882487 TTGTGCCAGGCTTTGTGCTAGGG + Intronic
1085776285 11:79369740-79369762 TTCTGGAAGGATATGGGCTAAGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1089064259 11:115650488-115650510 CTCTGGAGTGCTAAGTGCTATGG + Intergenic
1090370600 11:126248851-126248873 CTGTGAAATGCCATTTGCTAGGG - Intronic
1091053129 11:132392895-132392917 CTGGGGTATGCTGTGTGCTATGG + Intergenic
1092427044 12:8383076-8383098 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1092685973 12:11046704-11046726 CTGTGGGAGGCTTGGTCCTATGG + Intronic
1093984790 12:25518606-25518628 CAGTGGAAGACACTGTGCTAGGG + Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096846204 12:54408401-54408423 GGGTGGGAGGCTATGTGCCAGGG + Intronic
1097171872 12:57119429-57119451 CTGGGCAAGGCTATGTAGTATGG + Intronic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1099206061 12:79727775-79727797 CTGGGAAAGGCTATGTGTTCTGG - Intergenic
1099623051 12:85028528-85028550 CTGTTGAATGCTTGGTGCTATGG + Intronic
1100965340 12:100006929-100006951 CTGAGCAAGGCAATGTGCAAGGG - Intergenic
1102201538 12:111060901-111060923 CTCTGGAAGGCCAAGTGCCAGGG + Intronic
1103458764 12:121087513-121087535 CTTTGGGAGGCTCTGTCCTATGG - Intergenic
1104834162 12:131776614-131776636 CTGTGAAAGGCAAAGTGGTAAGG - Intronic
1106287295 13:28328965-28328987 CTGGGGAAGACAATCTGCTAGGG - Intronic
1107000734 13:35541638-35541660 CAGTAAAAGGCTATGTGCTGTGG + Intronic
1107243114 13:38261411-38261433 ATAAGTAAGGCTATGTGCTATGG - Intergenic
1107399492 13:40055548-40055570 GTGTGGAAGGCTGTTTGCCAAGG + Intergenic
1108152604 13:47551829-47551851 CTGTAGAAGACTTTGTGCCATGG + Intergenic
1113528811 13:111004674-111004696 TTGTGGAGGGCCATGTGCTTTGG + Intergenic
1114267437 14:21081259-21081281 GAGTGGCAGGCTCTGTGCTAAGG - Intronic
1116693659 14:48144420-48144442 CCATGCATGGCTATGTGCTAGGG - Intergenic
1119509033 14:75196776-75196798 CTATGTAGGGCTCTGTGCTAAGG + Intergenic
1121868354 14:97384001-97384023 CTATGCAAAGCCATGTGCTATGG + Intergenic
1124248706 15:28094177-28094199 CAGAGGTAGGCTGTGTGCTAGGG - Intronic
1124494965 15:30180752-30180774 CTGTGGAAGGATTTGAGCAAAGG - Intergenic
1124748602 15:32357893-32357915 CTGTGGAAGGATTTGAGCAAAGG + Intergenic
1125603722 15:40928710-40928732 CTGAGCAAGGCTAGGGGCTAAGG - Intergenic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1129344417 15:74907506-74907528 GTGTGGTAGGCTATGTGTCAGGG + Intergenic
1130684643 15:86026014-86026036 CTGTGGAAAGCTGGGTGCTGTGG + Intergenic
1130939263 15:88494199-88494221 CTGGGGAAGGGTATGGGGTAGGG - Intergenic
1137584920 16:49658608-49658630 CTGGGGAAGGCTCTGGGATATGG + Intronic
1140911668 16:79459316-79459338 ATGTGAAAGGCTTTGTTCTAGGG + Intergenic
1142420389 16:89966263-89966285 GTGTGGAGGGCTCTGTGCCATGG - Exonic
1143459808 17:7095087-7095109 CTGTGGAATGCTACGTGAGAGGG - Intergenic
1144728402 17:17513130-17513152 CTGGGGCATGCTCTGTGCTAGGG + Intronic
1145166088 17:20614309-20614331 GTGTGGAGGGCTCTGTGCCATGG - Intergenic
1149785523 17:59431480-59431502 ATGTGGAAGGCACTGTGCTCAGG - Intergenic
1151619554 17:75237625-75237647 CAGTGGCAGGCTGTGTCCTATGG - Exonic
1151626141 17:75277146-75277168 CTGTGGAAGGATCTGGGCCAAGG - Intronic
1153963062 18:10156380-10156402 CTTTGGAAGGAAATGTGGTAAGG - Intergenic
1157106568 18:44779661-44779683 CTGTCGAAGACTTTGTGCAAAGG + Intronic
1159388417 18:67757403-67757425 CTGTGGAATGCTATAAACTACGG - Intergenic
1159541739 18:69786666-69786688 CTGTTGCAAGCTTTGTGCTAAGG - Intronic
1160460171 18:79033260-79033282 TTGTGGAAGGCTATGAGACATGG - Intergenic
1160460210 18:79033482-79033504 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460353 18:79034296-79034318 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460379 18:79034444-79034466 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460392 18:79034518-79034540 TTGTGGAAGGCTATGAGACATGG - Intergenic
1160460418 18:79034666-79034688 TTGTGGAAGGCTATGAGACATGG - Intergenic
1160460431 18:79034740-79034762 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460599 18:79035702-79035724 TTGTGGAAGGCTATGAGACATGG - Intergenic
1160460664 18:79036072-79036094 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160460676 18:79036146-79036168 TTGTGGAAGGCTATGAGACATGG - Intergenic
1160460689 18:79036220-79036242 TTGTGGAAGGCTATGAGACATGG - Intergenic
1160460767 18:79036664-79036686 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460780 18:79036738-79036760 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460819 18:79036960-79036982 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460832 18:79037034-79037056 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1162378847 19:10320559-10320581 CTATGCCAGGCCATGTGCTAGGG - Intronic
1164145804 19:22511824-22511846 CTGTTGAGGGCTAAGTGCTGGGG + Intronic
1164677363 19:30110612-30110634 CTGTGAAAGGGTTTGTGCTTTGG + Intergenic
925579402 2:5395335-5395357 CTGTAGAAGCACATGTGCTAGGG + Intergenic
926885773 2:17597217-17597239 CTGGGGAAGGGTTTGTGCTTAGG - Intronic
927904221 2:26846039-26846061 CTATGCCAGGCAATGTGCTATGG + Intergenic
930875976 2:56216984-56217006 CTGTTAAAGGCTAAATGCTAAGG - Intronic
932469547 2:71944936-71944958 CTGTGATAGGCACTGTGCTAGGG - Intergenic
933651254 2:84852167-84852189 CTGTAGAAGAGTATGTGCTGGGG - Intronic
935693289 2:105748935-105748957 CTGTGGAAGGCTTTGACCTCAGG + Intronic
935946376 2:108290030-108290052 CTGTGGTAGGCGTTGTGCTCTGG - Intronic
940372739 2:152921073-152921095 CCGTGGAAGGCATGGTGCTATGG - Intergenic
943157809 2:184207136-184207158 CTGTGATAGTGTATGTGCTATGG + Intergenic
945263002 2:207862347-207862369 CTGAGGGAGGCTGGGTGCTATGG + Intronic
946087922 2:217193257-217193279 GTGTGGAAAGCTGTGTGCAAAGG + Intergenic
1171213572 20:23335497-23335519 ATCTATAAGGCTATGTGCTATGG - Intergenic
1173155652 20:40606399-40606421 CTGGCTAAGGCTATGTGTTAAGG - Intergenic
1173667830 20:44775318-44775340 CTGTAGCATGCTATGTGCTGTGG + Intronic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1178006185 21:28222628-28222650 AGGTTGAAGGCCATGTGCTAAGG + Intergenic
1178405603 21:32320823-32320845 CTGTGGAAGTCTGTGTCCTCTGG - Intronic
1182927138 22:34135634-34135656 CTGTGGATGGCTAAAGGCTAGGG + Intergenic
1183273844 22:36878810-36878832 CTGTGGAAGGTTAGGAGCTGAGG - Intergenic
1184173324 22:42772244-42772266 CAGAGGAAGGCCATGTGCGAGGG + Intergenic
953658256 3:44871235-44871257 CTGTGCCATGCTATGGGCTAGGG + Intronic
954576015 3:51676722-51676744 CTGTTGAGGGCTAAGTGCTGGGG - Intronic
954579621 3:51696237-51696259 CTGTGGAAGGGGATGTGCCAGGG + Intronic
957845470 3:85728330-85728352 ATGCGGAAAGCTATGTGTTAAGG - Intronic
958195963 3:90243279-90243301 CTGTAGAAGGGTATGTGGAATGG + Intergenic
958419150 3:93911913-93911935 CTGTAGAAGGGTATGTGGAATGG + Intronic
961076895 3:123991148-123991170 CTCTGGAAGGGTATGTACAATGG - Intronic
961282395 3:125774314-125774336 CTGTGGAAGGATAGGGGCTTTGG - Intergenic
961307687 3:125970162-125970184 CTCTGGAAGGGTATGTACAATGG + Intronic
961557521 3:127706809-127706831 CCGTGGAAGGCTGTGTCCTGGGG + Intronic
962470356 3:135702384-135702406 CTGTGGAATTCTATGTGCCCTGG + Intergenic
963007387 3:140738845-140738867 CTGAGAAAGGCAATTTGCTAAGG - Intergenic
963626179 3:147676891-147676913 CTGTGAAAGGCTGTGTGGTCAGG - Intergenic
964833010 3:160906855-160906877 CTGTGGAAGCTTATGTGGCAAGG - Intronic
965719009 3:171640747-171640769 CTGTGTAGGGCTGTGTGCAACGG - Intronic
966532513 3:180996587-180996609 CTGAGGAAGGCAATGGGCAAAGG - Intergenic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
968708741 4:2096780-2096802 TTGTGGATGGCTTTGTGCTGGGG + Intronic
970752721 4:19384366-19384388 CTGGGAAAGGCTCTGAGCTAGGG - Intergenic
973916099 4:55636201-55636223 CTGCGGGAGGCTCGGTGCTAGGG + Exonic
976221039 4:82757054-82757076 CTGTGGAAGGTGAGGTGCCATGG - Intronic
977202011 4:94128394-94128416 ATGTGGAAGATTATGTGCAAAGG - Intergenic
977263717 4:94829550-94829572 CTGTTGAAGGCCAGGTGCCATGG - Intronic
978938911 4:114414345-114414367 CTTTGGGAGGCCATCTGCTATGG + Intergenic
979288827 4:118957392-118957414 CTGTGTAAGAGTATGTGCTTTGG + Intronic
979306555 4:119151386-119151408 CTGTGGAGCGCTATGTGCTTTGG - Intronic
982944689 4:161605283-161605305 CTGTGGAAGGCTATGTGCTATGG - Intronic
985475488 5:76668-76690 CTGTGGAAACCTCTGTGCTAGGG + Intergenic
985724155 5:1506918-1506940 CTGTGGAAGCCTCTGAGCCAGGG - Intronic
987101621 5:14596262-14596284 CTGTGGAAGGCTTGGTGATTGGG - Intronic
989685442 5:44081272-44081294 CTGTGGAAAGCTAAGTGTTATGG + Intergenic
989854038 5:46256461-46256483 CTGTGAAAGGATATTTGGTAAGG - Intergenic
990013098 5:51023951-51023973 CTTTGGAAGGTTCTGAGCTATGG + Intergenic
990328486 5:54701610-54701632 CTGGGCCAGGCAATGTGCTAGGG - Intergenic
992757022 5:79916942-79916964 CTGTGGGAGGCAGTGGGCTAGGG + Intergenic
992816024 5:80439409-80439431 CTGTGGAAGCCAATTTGCTCTGG - Intronic
994459246 5:100052205-100052227 CTGTGGTAGGAGATGGGCTAGGG + Intergenic
994599279 5:101881677-101881699 ATGTGGAAGGCCATGTGCTGTGG + Intergenic
996387464 5:122924666-122924688 ATGTGCCAGGCTAGGTGCTAAGG + Intronic
997382945 5:133450395-133450417 CTGGGGGAGGCTATGGGCTCCGG + Intronic
997900926 5:137763425-137763447 CTGTGCATGGGTATGTGCTGGGG - Intergenic
998079619 5:139263733-139263755 CTGTGGAAGGTCATGTGATAAGG + Intronic
1000438220 5:161239754-161239776 GTGTGCTAGGCTATGTGCAAAGG - Intergenic
1000929043 5:167229926-167229948 CTGTGGAATGCTGTGGGCCAAGG - Intergenic
1007350613 6:41270991-41271013 CTGTGTGAGGCCAAGTGCTATGG - Intronic
1007481232 6:42151456-42151478 CTGTGTCAGGCTCTGTGCTCAGG + Intergenic
1007999122 6:46340019-46340041 TTATGGCAGGCAATGTGCTAAGG - Intronic
1012865499 6:104613457-104613479 CTGTGGTAGACAGTGTGCTAAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1018285393 6:162232262-162232284 CTGTTGAAGGCTATGTGCTCAGG + Intronic
1019121252 6:169806309-169806331 CTGTGGAGAGCTCTGTGATATGG - Intergenic
1019165578 6:170095621-170095643 CTGGGGAGGGCTGTGTTCTAAGG + Intergenic
1022112535 7:27240267-27240289 CTGGGGAAGGCTTTGGGCTGAGG + Intergenic
1023170524 7:37386438-37386460 CTGTGGGAGGCTCTGTACAAGGG - Intronic
1024242099 7:47443457-47443479 CTGTGAAAGGCTTTGGGTTAGGG - Intronic
1026491255 7:70865984-70866006 CTTTGGAAGGCCAAGTGGTAAGG - Intergenic
1027335981 7:77151207-77151229 CTGTGGAAGGCCATGTGGGTGGG - Intronic
1029074006 7:97921742-97921764 CTGTGGAAGGATAGGGGCTTTGG + Intergenic
1029779807 7:102719889-102719911 CTGTGGAAGGCCATGTGGGTGGG + Intergenic
1033493169 7:141864488-141864510 TTCTGGAAGGCGATGTGATAAGG + Intergenic
1034901307 7:154909657-154909679 CTGTGGAAGGCTGTCTGGGAGGG - Intergenic
1036200079 8:6763479-6763501 CTGTGTTAGGCGCTGTGCTAGGG + Intergenic
1036667381 8:10756310-10756332 GTGGTGAAGGCTCTGTGCTAGGG - Intronic
1039367478 8:36945438-36945460 CTGTGGAATTCAATCTGCTAGGG - Intergenic
1040660021 8:49561941-49561963 CTCTGGGATGCTTTGTGCTAGGG + Intergenic
1043809009 8:84710916-84710938 CTATGTAATGCTAAGTGCTATGG + Intronic
1048856928 8:138694016-138694038 CTCTGGGAGACTCTGTGCTATGG - Intronic
1050317696 9:4420064-4420086 CTGTTGAAGGCTATCAGCTGTGG + Intergenic
1052688253 9:31780964-31780986 CTCATGAAGACTATGTGCTAGGG - Intergenic
1052750836 9:32488335-32488357 ATGTGTCAGGCTCTGTGCTAAGG - Intronic
1057025973 9:91734009-91734031 CTCTGGAAGGTTCTGTGATAAGG + Intronic
1058641887 9:107095612-107095634 CTTTGGAAGCCTAAGTGCAAGGG - Intergenic
1059306987 9:113361505-113361527 ATATGGAAGGATATGTGCTATGG + Intronic
1060367543 9:123033676-123033698 CTTTGCAAGGCTTTCTGCTAAGG + Intronic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060845920 9:126837515-126837537 CTGGGGAAGGGGATGTGCTGCGG + Exonic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061807225 9:133143254-133143276 CTGTGGAAGGCTCAGGGGTATGG - Intronic
1189171635 X:38915101-38915123 CTGTGGGAGGGTCTGTGCAAGGG + Intergenic
1192587229 X:72328626-72328648 CTGAGGAAGACTTTGTGCTCAGG - Intergenic
1196692530 X:118576171-118576193 ATGTGGCAGGGCATGTGCTAGGG - Intronic
1196793042 X:119481512-119481534 ATGTGGAGGGCTCTGTGTTAGGG - Intergenic
1198341944 X:135723164-135723186 CTCTGGAAGGCTATTTGATTCGG - Exonic
1198346050 X:135760199-135760221 CTCTGGAAGGCTATTTGATTCGG + Exonic
1199296443 X:146164271-146164293 CTGTGCCAGGTTCTGTGCTAAGG - Intergenic
1199818977 X:151425706-151425728 CTGCGGGAGTCTATGTGGTATGG + Intergenic
1199823898 X:151478393-151478415 CTGTGGCAGGCTGAGTGCCATGG - Intergenic
1200761312 Y:7041804-7041826 CTGTGGAAGTCTAGGGGCGATGG - Intronic