ID: 982945048

View in Genome Browser
Species Human (GRCh38)
Location 4:161611606-161611628
Sequence ACCAATGAGTTGCCTCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982945048 Original CRISPR ACCAATGAGTTGCCTCCATC AGG Intronic
911041989 1:93598519-93598541 ACCAAACAGTTGCCAGCATCTGG + Intronic
913377418 1:118168448-118168470 ACCAATGAGTTGGCTGATTCTGG + Intronic
918547333 1:185700007-185700029 TCCACTGAGTTGCCTCCAGCAGG - Intergenic
920075897 1:203336299-203336321 AGCAATGTGTTTGCTCCATCTGG + Intergenic
924236984 1:242007362-242007384 ACCACTGAGTTGTCTCCTTGAGG + Intergenic
1062909835 10:1205399-1205421 TCCAGTGAGTTGTCTCCCTCAGG - Intronic
1068611712 10:59067667-59067689 ACCAATATTTTGCCTCCTTCTGG - Intergenic
1073616110 10:104997851-104997873 ATCAATGAAGTGTCTCCATCTGG + Intronic
1074313172 10:112339961-112339983 ACAAATGAGATGCCTCCAGAGGG - Intergenic
1074415224 10:113261584-113261606 AACAATTAGATCCCTCCATCTGG - Intergenic
1078052870 11:7983026-7983048 AGCATTAAGTTCCCTCCATCTGG + Intronic
1078709932 11:13781356-13781378 ACCACAGAGTGGCCTCCAGCTGG + Intergenic
1088852503 11:113716352-113716374 ACAATAGAGTAGCCTCCATCTGG + Intergenic
1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG + Intronic
1103615240 12:122147664-122147686 ACCAGTGAGTTCTGTCCATCTGG - Intergenic
1109825149 13:67709360-67709382 ACAAATAAGATACCTCCATCTGG - Intergenic
1119842557 14:77804307-77804329 GCAAATGAGTTGCTTCCCTCGGG - Intronic
1129723026 15:77888284-77888306 AACATTGAGTTGCCTCCAATAGG + Intergenic
1133835160 16:9361374-9361396 ACCAATGAGTTTCCTGCTTTGGG + Intergenic
1137949624 16:52771352-52771374 TCCACTGAGAGGCCTCCATCTGG + Intergenic
1144914573 17:18713041-18713063 ACCACTGAATTGCCTGTATCAGG - Intronic
1145247374 17:21278342-21278364 ACCAATGAGTTGTCTCAGCCAGG - Intergenic
1148208557 17:45794577-45794599 ACCAAAGAGTTTCCTCCTCCTGG - Intronic
1157910241 18:51610652-51610674 ACCACTCAATTACCTCCATCTGG + Intergenic
1165063830 19:33217995-33218017 GCCTTTGAGTTCCCTCCATCCGG + Intronic
928672869 2:33620467-33620489 ATCTGTGAGTTACCTCCATCAGG + Intergenic
929315747 2:40476345-40476367 ATGAATGAATTGCCTCCAGCAGG - Intronic
930200654 2:48549437-48549459 ATGAATGAGTTGTTTCCATCTGG + Intronic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
937498144 2:122447561-122447583 ACCTCTGAGTTTCCTGCATCTGG + Intergenic
945314628 2:208359199-208359221 ACCAATGAGATGCTTGCATAGGG - Intergenic
946604881 2:221392728-221392750 ACCAATCAGATGTCTCCATAGGG + Intergenic
1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG + Intergenic
1175186951 20:57185105-57185127 ACCATTCTGTTGCCTCCACCTGG - Intronic
1177226466 21:18263722-18263744 ATCAAGGGGATGCCTCCATCAGG + Intronic
1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG + Intergenic
1184341955 22:43891096-43891118 ACCAAGAAGTTGCGTCCGTCAGG + Exonic
1184754643 22:46508979-46509001 TCCAACCAGTGGCCTCCATCTGG + Intronic
955159799 3:56453629-56453651 ACAAATGATTTGCATCTATCTGG - Intronic
959019422 3:101172046-101172068 ACCAAGGTGTTGACTACATCAGG + Intergenic
962927536 3:140008635-140008657 GCCAATGCTTTGCCTCCATCAGG + Intronic
969587021 4:8099934-8099956 AACAATGTGTTGTCTCCATAAGG - Intronic
970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG + Intronic
970443657 4:16106670-16106692 ACCAAAGAGCTGCCTCTCTCAGG - Intergenic
971892098 4:32538010-32538032 AGCAATGAGTTTTCTCCAGCTGG - Intergenic
974321975 4:60362218-60362240 TCCCATGAGTTGCCTACATATGG + Intergenic
982945048 4:161611606-161611628 ACCAATGAGTTGCCTCCATCAGG + Intronic
983798599 4:171898668-171898690 ACCTATCAGTTGCCTGGATCTGG + Intronic
991521364 5:67501269-67501291 AATAATGAGTTGTGTCCATCAGG - Intergenic
1000516127 5:162237981-162238003 ACAATTGATTTACCTCCATCTGG + Intergenic
1004645203 6:17553877-17553899 ATCAAAGAGGTGCCTTCATCTGG + Intronic
1006721309 6:36153603-36153625 ACTGATGAGTTGACTCCCTCTGG - Intergenic
1008663896 6:53697067-53697089 GTCAATGTGTTACCTCCATCAGG - Intergenic
1015156408 6:130101508-130101530 ACCAATCAGATGCTGCCATCCGG + Intronic
1018049725 6:159998316-159998338 TCAAGTAAGTTGCCTCCATCTGG - Intronic
1018451109 6:163908220-163908242 ACAACTGAATTGCCTCCATCAGG - Intergenic
1020204552 7:6104932-6104954 GACAATGACGTGCCTCCATCCGG - Exonic
1020526830 7:9272783-9272805 ACCGATCAGTTGCCTTGATCTGG - Intergenic
1033038198 7:137894672-137894694 ACCAAGGGGATGCATCCATCTGG - Intronic
1039818560 8:41116218-41116240 ACCTTTGACTTGCCACCATCGGG + Intergenic
1042748381 8:72132610-72132632 AGGAATGAGTTGCCTCTCTCTGG - Intergenic
1048391970 8:133975259-133975281 GCCAATCAGTGGCCTCAATCAGG - Intergenic
1051149442 9:14064442-14064464 ACCAATGAGGGCCCACCATCTGG + Intergenic
1057703774 9:97383577-97383599 CCCTATGTATTGCCTCCATCTGG + Intergenic
1060796773 9:126517217-126517239 ACCAAGGAGATGACTACATCAGG + Intergenic
1185689597 X:2142910-2142932 ACCATTCAGTTGCATCCATTTGG - Intergenic
1187259798 X:17674585-17674607 AGCTATGAGTAGCCTCCATGGGG - Intronic
1189502968 X:41581918-41581940 ACCAATCAGTGGCCTCAATGAGG - Intronic
1191957790 X:66665062-66665084 ACAAATCAGTTGCCACCTTCAGG + Intergenic
1195240689 X:102949038-102949060 GCTAATGAGATGCCTCCACCGGG + Intergenic
1198513691 X:137381647-137381669 TCCAATGAATTGGCTCCCTCAGG - Intergenic
1198652235 X:138875379-138875401 AAGGATGAGTGGCCTCCATCAGG - Intronic