ID: 982946426

View in Genome Browser
Species Human (GRCh38)
Location 4:161629992-161630014
Sequence TCTGAGGAAGACTCCACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982946426_982946437 22 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946437 4:161630037-161630059 TGGGGGAATCAGGGAGAACTAGG No data
982946426_982946430 3 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946430 4:161630018-161630040 TGCAGCCGAGGCCTCTTAATGGG 0: 1
1: 0
2: 1
3: 3
4: 61
982946426_982946431 4 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946431 4:161630019-161630041 GCAGCCGAGGCCTCTTAATGGGG 0: 1
1: 0
2: 0
3: 9
4: 68
982946426_982946427 -9 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946427 4:161630006-161630028 TTCCTCAGACACTGCAGCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 169
982946426_982946432 5 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946432 4:161630020-161630042 CAGCCGAGGCCTCTTAATGGGGG 0: 1
1: 0
2: 0
3: 9
4: 80
982946426_982946429 2 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946429 4:161630017-161630039 CTGCAGCCGAGGCCTCTTAATGG 0: 1
1: 0
2: 0
3: 4
4: 80
982946426_982946435 13 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946435 4:161630028-161630050 GCCTCTTAATGGGGGAATCAGGG 0: 1
1: 0
2: 0
3: 4
4: 77
982946426_982946434 12 Left 982946426 4:161629992-161630014 CCTATAGTGGAGTCTTCCTCAGA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 982946434 4:161630027-161630049 GGCCTCTTAATGGGGGAATCAGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982946426 Original CRISPR TCTGAGGAAGACTCCACTAT AGG (reversed) Intronic
900520804 1:3104703-3104725 TCCAAGGAAGACTTCACTAGGGG - Intronic
902388711 1:16090480-16090502 TCTGAGGCAGGCACCATTATAGG - Intergenic
903563795 1:24249162-24249184 GCTGAGGAAGACTCCTCCACTGG - Intergenic
903913110 1:26743133-26743155 GCTGTGGATGGCTCCACTATGGG - Intronic
903998993 1:27327342-27327364 TCTGAGCATGACTTCACTGTTGG + Intronic
905181755 1:36171449-36171471 TCTGAGGCTGACTCCTCTTTGGG + Intronic
907344395 1:53762716-53762738 TCTGAGGAACACAACACCATAGG - Intergenic
908101069 1:60791655-60791677 TGTGAGGAAGACACTACTCTAGG + Intergenic
916637368 1:166687436-166687458 TATGAGGAAGCCTTCACTAGAGG + Intergenic
922984818 1:229858021-229858043 TCTGAGTAAGATTCCATTAAGGG - Intergenic
923077749 1:230624997-230625019 TCTGAGACAGAATCCACCATGGG - Intergenic
1066084050 10:31959810-31959832 TCAGAGGCAGGCTCAACTATTGG - Intergenic
1067981950 10:51097037-51097059 TTTGGGGAAGACCCCACTGTAGG - Intronic
1073054615 10:100691156-100691178 TTTCAGGAAGGCTCCATTATTGG - Intergenic
1074956375 10:118394700-118394722 TCTAAGGAAGCTTCCTCTATTGG + Intergenic
1076062215 10:127421819-127421841 GCTGAGTAATACTCCATTATAGG + Intronic
1077176320 11:1192736-1192758 TTTGAGCAGGACTCCACTAAAGG + Intronic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1079222193 11:18572930-18572952 TCTGAGGTGGGCTCTACTATTGG + Intronic
1087830287 11:102812588-102812610 TCTGGGGAAGATTCCACCCTGGG - Intergenic
1091710464 12:2736572-2736594 TATAAGGAAGACTCCACTGCAGG - Intergenic
1095383632 12:41624869-41624891 TCTGAGTAAGACACTATTATGGG + Intergenic
1096100221 12:48966291-48966313 TGTGAGCGAGACCCCACTATGGG - Exonic
1101089769 12:101273471-101273493 TCTGAGGCAGGCTCTAGTATGGG - Intergenic
1102653810 12:114463108-114463130 ATTGAGGAAGGCACCACTATGGG - Intergenic
1104107135 12:125673800-125673822 TCTGAGGAGCACGCCACTGTTGG - Intergenic
1104737791 12:131149241-131149263 TCTGAGGAAGAACACAGTATGGG - Intergenic
1106482518 13:30147556-30147578 TCTGAGCAGGACTCCCCTAGAGG + Intergenic
1110265231 13:73529869-73529891 TCTGAAGCAGTCTCCTCTATGGG - Intergenic
1111884016 13:93995897-93995919 TCTGGGGATGACTACAATATAGG - Intronic
1113133726 13:107065705-107065727 TCAGATGAAGATTCCCCTATTGG - Intergenic
1116521274 14:45850211-45850233 TTTGAGAAAGAGTGCACTATTGG - Intergenic
1120950591 14:90037956-90037978 TCTGAGGAACATTCTACTTTGGG + Intronic
1122147131 14:99698156-99698178 TAAGAGGATGACTCAACTATCGG - Intronic
1124895067 15:33768769-33768791 TCTGAGGAAGACACAAATAAAGG - Intronic
1126549473 15:49910615-49910637 TCTGATGGAGACTCCTTTATAGG - Intronic
1127569993 15:60232413-60232435 TCTGAAGAAGATTCCAATCTAGG - Intergenic
1129845589 15:78766417-78766439 CCTGAGGAAGACACCCCCATAGG - Exonic
1130256265 15:82327444-82327466 CCTGAGGAAGACACCCCCATAGG + Intergenic
1130336112 15:82958634-82958656 TCTTAGCAAGACTCCAAGATTGG + Intronic
1130880609 15:88052551-88052573 TGTAGGGAAGACTCCACTCTTGG - Intronic
1131124581 15:89848167-89848189 TTTGAGAAAGACTCCACAGTAGG - Intronic
1134380394 16:13718972-13718994 TCTGCGGACGACTCCACAAATGG + Intergenic
1134777151 16:16863254-16863276 TCTCAAGAAGAGTCCAGTATTGG + Intergenic
1149314399 17:55424959-55424981 TCTGTGGAAGAGACCACTGTAGG - Intergenic
1152078551 17:78172755-78172777 TTGGAGGAAGACTCCACTCTGGG + Exonic
1153579448 18:6557545-6557567 CCTTAGGAAGACTTCACTGTTGG + Intronic
1154156649 18:11948966-11948988 TCCTGGGAAGACTCCACGATTGG - Intergenic
1155393431 18:25361375-25361397 TCTGGGGAAAACACCACCATGGG - Intergenic
1159095710 18:63899103-63899125 TCTGAGGATGCCTCAACTACAGG + Intronic
1159887780 18:73925416-73925438 GCTGATGAAAACTACACTATCGG + Intergenic
1166243093 19:41507382-41507404 GCCCAGGGAGACTCCACTATGGG + Intergenic
1168653240 19:58107233-58107255 TCTGAGGAAGTCTCAACAGTGGG + Intronic
929906697 2:46052162-46052184 TCTTAGGTAGACTCAACTACTGG - Intronic
930263896 2:49177515-49177537 GCTCAGAAAGACTCCGCTATTGG - Intergenic
931694611 2:64862354-64862376 TCTGTGGAAGACTGAATTATGGG + Intergenic
933890854 2:86768447-86768469 TCTGAGGAAGACTCTAAAGTGGG + Intronic
937026365 2:118701270-118701292 ATTGGGGAAGACTTCACTATAGG + Intergenic
939670154 2:145001271-145001293 TCTGAGCCACACTCCACCATTGG + Intergenic
943540075 2:189202677-189202699 TCTGAGGAAGATAATACTATGGG + Intergenic
948251744 2:236535357-236535379 TCTTAGCAAGCCTCCACTTTCGG - Intergenic
1170211573 20:13850686-13850708 TCTGGGGAAGAATCCACTGCAGG - Intronic
1170284318 20:14689487-14689509 TTTAAGGAAAAATCCACTATCGG - Intronic
1171511768 20:25691639-25691661 TCTGAGAGAAACTCCACTGTGGG - Intronic
1174470492 20:50756515-50756537 TCTCAGGTAGACTGCAATATGGG + Intronic
1184015270 22:41781348-41781370 TCTGATGAAGGCTCCAATACAGG - Exonic
1184298794 22:43542976-43542998 CCTGAGAAAGACACCACCATGGG + Intronic
1184925856 22:47636863-47636885 GCTAAGGATGACTGCACTATAGG + Intergenic
949447349 3:4149306-4149328 CCTCAAGAAGACTCCATTATGGG - Intronic
955945061 3:64185691-64185713 CCTTAGGAAGCCTCCACCATTGG + Intronic
960071566 3:113437010-113437032 TCTGAGGAAGAATCTACTTCTGG + Intronic
960172870 3:114483239-114483261 TATGAGGAAGACATCATTATGGG - Intronic
960458691 3:117905807-117905829 TCTTAGCAAGAGTCCACTGTAGG - Intergenic
960723934 3:120651259-120651281 TCTCAAGTACACTCCACTATGGG + Intronic
963102277 3:141619050-141619072 TCTCAGGAAGAGTCCACTGGAGG - Intergenic
963953285 3:151226057-151226079 TCTCAGGAAGATTCCAGTCTAGG + Intronic
965674319 3:171179030-171179052 TCTCAGGTAGACTGCACTTTAGG - Intronic
977127672 4:93189949-93189971 TCTGAGAATGACACCAGTATTGG + Intronic
978545877 4:109872516-109872538 TCTGAGGAACACTCTACAGTGGG + Intergenic
978965740 4:114739056-114739078 TTTGAGGAAGACTTCTTTATTGG + Intergenic
982946426 4:161629992-161630014 TCTGAGGAAGACTCCACTATAGG - Intronic
983956893 4:173708702-173708724 TCTGTAGAAGACTCTACTAATGG - Intergenic
986974205 5:13376968-13376990 TTTGAGGAACAGTCCCCTATTGG - Intergenic
989326424 5:40201297-40201319 TCTGAAGAAGAATCTACTTTAGG - Intergenic
989430547 5:41350022-41350044 TCTGTGGATGACTCCGCAATGGG + Intronic
990020838 5:51125489-51125511 TCTAAAGAAGACTCCAATAAAGG + Intergenic
991164422 5:63547006-63547028 TGTGAGGATGACTGGACTATGGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1010789140 6:80044603-80044625 TCTTTGGAAGACGCCATTATAGG - Intergenic
1012990411 6:105920302-105920324 TAAGAGGAAGATTTCACTATGGG - Intergenic
1016921399 6:149298325-149298347 TCAAATCAAGACTCCACTATTGG + Intronic
1017273732 6:152540897-152540919 ACTGTGGAAGAATCCACTTTTGG - Intronic
1022605335 7:31807796-31807818 TCTGAGCCAGACTCTATTATAGG - Intronic
1029858200 7:103540340-103540362 CCTGAAGAAGACTCCACGAGAGG + Exonic
1030984158 7:116221369-116221391 TCTGAGGAAGATTCCAATCAGGG - Intronic
1031053728 7:116971675-116971697 CCAGGGAAAGACTCCACTATTGG - Intronic
1031338729 7:120571782-120571804 TTTGAGGAAGACTACACTACTGG - Intronic
1032007782 7:128317708-128317730 TCTAAAGAGAACTCCACTATTGG + Exonic
1032728348 7:134613226-134613248 TGGGAGTAAGACTCCACTAAGGG + Intergenic
1034950478 7:155293323-155293345 TCTGAGGATGAGTCCACTGTTGG + Intergenic
1039438471 8:37578190-37578212 GCTGAGGAAGACTCCATTTGGGG - Intergenic
1041186565 8:55307169-55307191 TCTGTGGAAGACTCTGCTAAGGG + Intronic
1042806663 8:72777895-72777917 TCTGAGGAAAAATCCAGTACTGG + Intronic
1042940641 8:74103758-74103780 TCTTAGGAAGAAAACACTATGGG + Intergenic
1043291302 8:78604915-78604937 TCTAAGTAAGACTCAAGTATAGG - Exonic
1048045367 8:130767739-130767761 TCTGAGGAAGTGTCCACTACTGG - Intergenic
1048491233 8:134895779-134895801 TCTGACGAAGCCTCAGCTATTGG - Intergenic
1049723957 8:144136887-144136909 TCTGGGGCAGACTCCAATACTGG + Intergenic
1050463826 9:5899528-5899550 TCTGAACAAGACTCCAATATTGG + Intronic
1051526584 9:18051484-18051506 TCTGAGGAGGACCCAACTTTAGG - Intergenic
1057303746 9:93900884-93900906 TCTGAGGAAGTCTCCATTGCTGG - Intergenic
1062002080 9:134221320-134221342 TTGGAGGAAGCCTCCAGTATTGG - Intergenic
1062290055 9:135790359-135790381 CCTGGGGAAGACCCCACCATGGG + Intronic
1186059241 X:5685930-5685952 TCTGAGTAAGACTCCACCTGGGG - Intergenic
1186222546 X:7365294-7365316 TGTGAACAATACTCCACTATGGG + Intergenic
1190018872 X:46853776-46853798 TTTGAGGAAGACTCAATGATGGG - Exonic
1193136169 X:77972831-77972853 CCTAAGGAAGACTCTATTATTGG + Intronic
1196357763 X:114813326-114813348 TCTGAGTGAGACTCCAAGATGGG - Intronic
1199229279 X:145417213-145417235 TTTGAGGAATACTTCACTAGAGG - Intergenic
1200167047 X:154043570-154043592 TCTGAGGAAGAGGCCAATGTGGG + Intronic