ID: 982946455 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:161630135-161630157 |
| Sequence | GTTTTATGGACCTGGAACGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 144 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982946455_982946463 | 15 | Left | 982946455 | 4:161630135-161630157 | CCTCCGTTCCAGGTCCATAAAAC | 0: 1 1: 0 2: 0 3: 9 4: 134 |
||
| Right | 982946463 | 4:161630173-161630195 | TTCAGCTTCACTGTGCAGTGAGG | 0: 1 1: 0 2: 1 3: 24 4: 232 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982946455 | Original CRISPR | GTTTTATGGACCTGGAACGG AGG (reversed) | Intronic | ||