ID: 982946455

View in Genome Browser
Species Human (GRCh38)
Location 4:161630135-161630157
Sequence GTTTTATGGACCTGGAACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982946455_982946463 15 Left 982946455 4:161630135-161630157 CCTCCGTTCCAGGTCCATAAAAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 982946463 4:161630173-161630195 TTCAGCTTCACTGTGCAGTGAGG 0: 1
1: 0
2: 1
3: 24
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982946455 Original CRISPR GTTTTATGGACCTGGAACGG AGG (reversed) Intronic