ID: 982948521

View in Genome Browser
Species Human (GRCh38)
Location 4:161658910-161658932
Sequence CAATTGCTACTAAGTTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982948520_982948521 -10 Left 982948520 4:161658897-161658919 CCATTTAGAAATACAATTGCTAC 0: 1
1: 0
2: 1
3: 25
4: 293
Right 982948521 4:161658910-161658932 CAATTGCTACTAAGTTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982948521 Original CRISPR CAATTGCTACTAAGTTACCC TGG Intronic
No off target data available for this crispr