ID: 982953232

View in Genome Browser
Species Human (GRCh38)
Location 4:161727610-161727632
Sequence CCTAACCCTGCATTTTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982953226_982953232 -5 Left 982953226 4:161727592-161727614 CCAGTTCTAACCCCTGACCCTAA 0: 1
1: 0
2: 3
3: 12
4: 152
Right 982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG 0: 1
1: 0
2: 2
3: 22
4: 238
982953224_982953232 1 Left 982953224 4:161727586-161727608 CCCTGACCAGTTCTAACCCCTGA 0: 1
1: 0
2: 0
3: 12
4: 125
Right 982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG 0: 1
1: 0
2: 2
3: 22
4: 238
982953225_982953232 0 Left 982953225 4:161727587-161727609 CCTGACCAGTTCTAACCCCTGAC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG 0: 1
1: 0
2: 2
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982953232 Original CRISPR CCTAACCCTGCATTTTTGCA TGG Intronic
901318772 1:8326357-8326379 CCTAACCCTGTATTTTTCCTAGG - Intronic
902489028 1:16766991-16767013 CCTAATACTGCATGTGTGCAGGG - Intronic
902638653 1:17751719-17751741 CCAAAGCCTGCCTTTTTCCATGG + Intergenic
902844212 1:19096668-19096690 CCTTACCCTCCATTTCTGCTTGG - Intronic
903098288 1:21001892-21001914 CCTGCCCCTGCCTTTTTGCCTGG - Intronic
905515190 1:38557629-38557651 CCTGACCCTGCCTTGCTGCAGGG + Intergenic
905900647 1:41580230-41580252 CCTCACCCTGCATTGTCCCATGG - Exonic
908286372 1:62608036-62608058 CCTAACACTGCATTCTAGCCTGG + Intronic
908760672 1:67508902-67508924 CCTGACACTGCATTTTTGAGTGG + Intergenic
910094554 1:83506076-83506098 TCTGACCCTGGATCTTTGCATGG + Intergenic
912751082 1:112288298-112288320 CCTAACTCTGCACTTTTCCAAGG + Intergenic
914916215 1:151820864-151820886 CCTATTCCTGCCTTTTTGCCAGG + Intronic
915554511 1:156653969-156653991 CCTAGCCCTGCATCTCAGCAGGG + Intronic
917060970 1:171038959-171038981 ACTGAACCTGCATTTCTGCATGG + Intronic
917216954 1:172688992-172689014 CCCAAACCTTCATTTTTGAAGGG + Intergenic
917576482 1:176326807-176326829 CCTTACCCTGAATGTGTGCATGG - Intergenic
917649999 1:177066965-177066987 ACTAACCCTGCAGTCTTTCAAGG + Intronic
919331270 1:196175249-196175271 CCTAACCCTGAATTGTTCAAGGG + Intergenic
921668839 1:217904515-217904537 CCTAACCCTGTATTTTTCCTAGG + Intergenic
922505652 1:226123990-226124012 CCTGTCCCTGCATCTTTGCCTGG + Intergenic
922554681 1:226523750-226523772 CCTAACCCTTCACCTTTGCTGGG - Intergenic
923531406 1:234815534-234815556 CCTAATACTGCATGTGTGCAGGG + Intergenic
924669191 1:246105831-246105853 TCAAACCCTCTATTTTTGCATGG + Intronic
1067138854 10:43637803-43637825 CCTAACCCTGTATTTCTCCTAGG - Intergenic
1068317151 10:55360843-55360865 CTTAACTATGCATTTTTGTATGG - Intronic
1069096399 10:64264825-64264847 CCAACCCCTGCATTGTTGAAGGG - Intergenic
1069291686 10:66787788-66787810 ACTAAATCTGCATTTTTGCAAGG - Intronic
1070307076 10:75245999-75246021 CATTTCCCTGCATTTCTGCAGGG - Intergenic
1072687146 10:97544482-97544504 CCTAACCCTGCGTTGTTCAAGGG - Intronic
1074104437 10:110377791-110377813 CCCAGCCCTGCTTCTTTGCAGGG + Intergenic
1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG + Intronic
1077486321 11:2839998-2840020 CCCAACCCTGCATTGTTCAAGGG - Intronic
1077736273 11:4794911-4794933 CCTCACCCTGCCATTTTGCAGGG - Intronic
1078449009 11:11426446-11426468 CTGAAACCTGCATTTTAGCATGG - Intronic
1079710292 11:23674988-23675010 CCTAATCCTCTATTTTTTCAAGG - Intergenic
1080490858 11:32762898-32762920 CCTAATACTGCACTTTTCCAAGG + Intronic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1081150662 11:39626770-39626792 TCTTACCCTGCATTTTTGTCTGG + Intergenic
1082943745 11:58735900-58735922 CCTACTCATGTATTTTTGCATGG - Intergenic
1086573679 11:88313837-88313859 CCAAACCCTGCATTTGATCATGG - Intronic
1087181726 11:95148854-95148876 ACTAATACTGCATTTTTGAAAGG - Intergenic
1088390059 11:109304508-109304530 CCTAACCCTGTATTTTACCTAGG + Intergenic
1088706053 11:112465690-112465712 CCCACCCCTACATTTTTTCAAGG - Intergenic
1090105943 11:123853791-123853813 TCCACCCCTGCATCTTTGCAGGG - Intergenic
1091166878 11:133486159-133486181 CCTAACCCTGTATTTTCTCTAGG + Intronic
1093423210 12:18998712-18998734 CCTAGCCCTGAATTTTTCCCAGG + Intergenic
1093495429 12:19751667-19751689 CATAACCCTGAAGGTTTGCATGG - Intergenic
1096040601 12:48512620-48512642 CCTAACCTTGTATTTCCGCAAGG + Intronic
1096285840 12:50299304-50299326 CCTAATTCTGTTTTTTTGCATGG + Intergenic
1097993795 12:65865319-65865341 CCAACCCCTGCATTGTTGAAGGG + Intronic
1098050670 12:66449182-66449204 CCTGACCCTGAGTTTTTGAAAGG + Intronic
1098225403 12:68316901-68316923 CCTAACCCAGCTTTATTTCATGG + Intronic
1098385249 12:69911682-69911704 TGAAATCCTGCATTTTTGCAAGG + Intronic
1099237421 12:80098117-80098139 CCTAACCCTGCATTTCCCCTAGG - Intergenic
1101575439 12:105992957-105992979 CCAAACACTGCAATTTTCCATGG - Intergenic
1102422031 12:112811093-112811115 CCTAACCCTGTATTTCTCCTAGG - Intronic
1105018691 12:132802159-132802181 CCTCACCCTGCATTTCTGCCAGG - Intronic
1106785291 13:33101586-33101608 CCTAATCCTGTATTTCTGCTAGG + Intergenic
1107090519 13:36474127-36474149 CCTAATACTGCACTTTTCCAAGG - Intergenic
1107792854 13:44019562-44019584 CCTAACTCTGTATTTCTGTAAGG + Intergenic
1109274002 13:60284312-60284334 ACTTACCCTGAAGTTTTGCAGGG - Intergenic
1110776030 13:79409029-79409051 CCTAATCCTGCATTTCTCCTAGG - Intergenic
1110823631 13:79945923-79945945 CCTGATCCTGAATTTATGCAGGG + Intergenic
1110833879 13:80062729-80062751 CCCAAACCTTCATTTTTGAAGGG + Intergenic
1110912019 13:80977174-80977196 CCTACCCCCGAAGTTTTGCAGGG + Intergenic
1110962757 13:81650452-81650474 ACTGACCCTGTATTATTGCAAGG + Intergenic
1111485897 13:88897498-88897520 CCTGGCCCTGCAGTTTTGCGAGG - Intergenic
1111700232 13:91677621-91677643 CTTAATGCTGCAATTTTGCAGGG - Intronic
1113276944 13:108740975-108740997 CCTAATACTGCACTTTTCCAAGG - Intronic
1113819734 13:113204515-113204537 CATCACCCTGCATATGTGCAGGG - Intronic
1114366304 14:22030512-22030534 CCTAGCCCTACAATTGTGCAGGG - Intergenic
1116405123 14:44557495-44557517 CCTAATACTGCACTTTTCCAAGG - Intergenic
1117263554 14:54062069-54062091 CCCAACCCTGCATTGTTGAAGGG + Intergenic
1117811467 14:59551768-59551790 CCTAATACTGCACTTTTCCAAGG + Intronic
1118885359 14:69861196-69861218 CATAACTCTGCCTTATTGCATGG - Intronic
1119019335 14:71094067-71094089 CCAACCCCTGCATTATTCCAGGG + Intronic
1120641096 14:87013804-87013826 CAGAACCCTTTATTTTTGCAAGG - Intergenic
1123903608 15:24900495-24900517 TCTAACCCAGCTTTTGTGCAAGG - Intronic
1124120654 15:26885723-26885745 CCAAACCCTTCCTTTTTCCATGG - Intronic
1124141658 15:27082374-27082396 CATAACCTTGCATTTATGCGGGG + Intronic
1125016540 15:34942774-34942796 CCTAACCCTGTATTTCCCCAAGG + Intronic
1125610641 15:40967318-40967340 GCTACCCCTGAATGTTTGCAAGG - Intergenic
1127616436 15:60690598-60690620 CCTAACCCTGTGTTTTTGTTAGG - Intronic
1128252780 15:66174552-66174574 TATAACTCTGCATTTTTCCAGGG + Intronic
1132773330 16:1577528-1577550 CCTACCCCTGCATTGTTCAAGGG + Intronic
1134240191 16:12500291-12500313 CCTGGCCCTGCATTTGTGAAAGG + Intronic
1134844303 16:17426913-17426935 CTTTACCCTATATTTTTGCATGG - Intronic
1135228083 16:20678984-20679006 CCTAGCCATGCATTTTTGCATGG - Intronic
1135562226 16:23485737-23485759 CATAACCCTCTATTTTTGCCTGG - Intronic
1137964861 16:52920645-52920667 CCCAACACTGCCTCTTTGCATGG - Intergenic
1138244179 16:55454270-55454292 CCTAACCCTGTCCTTATGCATGG + Intronic
1139852817 16:69961185-69961207 CCTGACCTTGCATTCCTGCAAGG - Intronic
1139881788 16:70184093-70184115 CCTGACCTTGCATTCCTGCAAGG - Intronic
1140370721 16:74411413-74411435 CCTGACCTTGCATTCCTGCAAGG + Intronic
1140501432 16:75436864-75436886 CCTAACCCTGTATTTCTCCCAGG + Intronic
1141285207 16:82665447-82665469 CCTAACCCTGCATTTCTACTAGG + Intronic
1141543155 16:84742536-84742558 CCTAACACAGCATTTCTCCAAGG - Intronic
1144584352 17:16479037-16479059 CCGGACCCTGCAGTATTGCAGGG - Intronic
1145815330 17:27791325-27791347 GCTAAAACTGCATTTTTACAAGG - Intronic
1145842990 17:28011950-28011972 ACTGATCCTGCATTTCTGCATGG - Intergenic
1146573759 17:33974425-33974447 CCTATCCCTGGATTTTTCCTTGG + Intronic
1147425332 17:40343451-40343473 CCTAACCTTCCATCTTGGCAAGG + Intronic
1149046965 17:52257126-52257148 GCTAACCCTGAATTATTGCTTGG + Intergenic
1149757723 17:59201469-59201491 CAGAACCCAGAATTTTTGCATGG - Intronic
1153916511 18:9750427-9750449 GCCAAGCCTGCATTTTTACAAGG - Intronic
1154243855 18:12677757-12677779 CCTAACCCAGGATTTTTTAAGGG + Intronic
1156982622 18:43308712-43308734 CCTAACCCTGGATTTTCCCTAGG + Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1157763055 18:50278761-50278783 CCTAACCCTGTATTTCTTCTAGG - Intronic
1158323196 18:56285657-56285679 CTTAATACAGCATTTTTGCAAGG - Intergenic
1158788489 18:60745002-60745024 CCTAACCTTGCATTTTTTCCGGG - Intergenic
1159139756 18:64379340-64379362 TCTAACCCTGCATTGTTCAAGGG - Intergenic
1161542857 19:4862545-4862567 CCTGACCCTGCATTTCTAAAAGG + Intronic
1163654408 19:18537521-18537543 CCCAACCCTGCATTTGAGAAAGG - Intronic
1164054355 19:21609366-21609388 CCTAGCCATGCATTTTTGCATGG - Intergenic
1165570074 19:36768660-36768682 CCTATCACTGCATTTTTAAAGGG - Intronic
1168595979 19:57677675-57677697 ACTAACCCTGAATTTTTCCTAGG + Intronic
925542045 2:4976816-4976838 CCTAACCTAGCATTTCTGCTGGG + Intergenic
926371500 2:12183394-12183416 ACCAATCCTGCACTTTTGCAAGG + Intergenic
926483907 2:13432110-13432132 TCTACCCCTGCAGCTTTGCAGGG + Intergenic
927279745 2:21294141-21294163 CCTAATCCTTCTGTTTTGCAGGG + Intergenic
929673246 2:43896369-43896391 CCTAATCTTGCATTTTTTAAGGG + Intronic
935591699 2:104851311-104851333 CCTAACCCTGGAAGTTTGCTCGG - Intergenic
935680453 2:105631663-105631685 CCTAACCCTGTATTTCTCCTGGG + Intergenic
935687552 2:105697707-105697729 CCCAACACTGCATTTTCCCAGGG + Intergenic
936393729 2:112101439-112101461 CCTAACCCTACATTGTTCAAGGG - Intronic
938813320 2:134873754-134873776 GCTAACCATCCATGTTTGCAGGG - Intronic
939511490 2:143111155-143111177 CCTAAGACTGTATTATTGCAAGG - Intronic
941717721 2:168781191-168781213 CCTAACCCTGTATTTCTCCTAGG - Intergenic
942066942 2:172280412-172280434 CTTTGCCCTGCATTTTTGGAGGG + Intergenic
943852684 2:192746518-192746540 CCGACCTCTGCATTTTTTCATGG + Intergenic
944353994 2:198763347-198763369 TCTAACCCTGCAATTTTGTGTGG - Intergenic
945141198 2:206688127-206688149 CCTAACCCTGTATTTTCTCTAGG - Intronic
1168733618 20:110217-110239 CCTAACCCTGCATATTTCAAAGG - Intergenic
1169964006 20:11195267-11195289 CCTCGCCCTGCATTCCTGCATGG - Intergenic
1170135413 20:13068777-13068799 ACTAGCCCTTCCTTTTTGCAGGG + Intronic
1171352288 20:24512439-24512461 CCTAATACTGCACTTTTCCAAGG + Intronic
1171529320 20:25842228-25842250 CCTATCACTGCATTTTTAAAGGG - Intronic
1171547506 20:26013652-26013674 CCTATCACTGCATTTTTAAAGGG + Intergenic
1171879753 20:30610017-30610039 TCTACCCCTCCATTTTTCCAAGG - Intergenic
1172391115 20:34566211-34566233 TCTAACCCTGCATTGTTACATGG + Intronic
1175246688 20:57586358-57586380 CCCAACCCTGCATTTTCCCGAGG + Intergenic
1175781387 20:61684417-61684439 CCTGCCCCTGCATTTTGGCTTGG - Intronic
1176664304 21:9670319-9670341 CATAACAGAGCATTTTTGCAGGG + Intergenic
1177063582 21:16401747-16401769 CTAACCCCTGCATTTTTGCATGG - Intergenic
1180641012 22:17299485-17299507 CCTAACACTGCCCTTTTCCAAGG - Intergenic
1183263778 22:36813342-36813364 ACTCTGCCTGCATTTTTGCATGG - Intronic
949647680 3:6116259-6116281 CCTAATCCTGCATTGTTCAAAGG - Intergenic
949974241 3:9440399-9440421 CCCAACCCTCTATTTATGCATGG + Intronic
950258699 3:11527929-11527951 CCCACTCCTGCATTTCTGCATGG - Intronic
950488073 3:13284670-13284692 CCTGACCCTGCAGTTGCGCACGG + Intergenic
952094445 3:29932213-29932235 GCTAAGCCTGCATTTTTGATGGG - Intronic
952904768 3:38132478-38132500 GCTAACCCTGCATGTTCCCATGG + Intronic
955289250 3:57675643-57675665 CCTAGCCCTGCTTCCTTGCAGGG - Intronic
957656718 3:83088155-83088177 CCTAACTCTGTATTTTTTCTTGG - Intergenic
957702536 3:83734919-83734941 CCTAAGCCTTCTTTTTTCCAGGG + Intergenic
957795434 3:84999241-84999263 TCTAACCCTGTATTTTCCCAAGG - Intronic
957903692 3:86531578-86531600 CCTAAACCTCTATTTTTGCAGGG - Intergenic
959218557 3:103484014-103484036 CCTAATACTGCACTTTTCCAAGG - Intergenic
963419548 3:145043413-145043435 CCTAACCCTGTATTTCTCCCAGG + Intergenic
964588137 3:158330075-158330097 CCTAATACTGCACTTTTCCAAGG - Intronic
964944270 3:162200480-162200502 CCTAACCCTGTATTTCTTCTAGG - Intergenic
967208980 3:187150089-187150111 TCTACCCCTGTATTTTTGCTTGG - Intronic
967756697 3:193178295-193178317 TGTACCCCTGCATCTTTGCATGG + Intergenic
970668724 4:18370678-18370700 CCAAAACCTGCTTTTTTGAAAGG + Intergenic
971235772 4:24840916-24840938 CCTAACCCTGCATTTCTTCTAGG + Intronic
971467478 4:26978848-26978870 CCCAACCCTGCATCCTTTCAAGG - Intronic
973713727 4:53654553-53654575 CCCAAACCTGCTTTTTTGCATGG + Intronic
975325608 4:73055363-73055385 CCTAACCCTGTATGTTTTCTAGG - Intergenic
976253891 4:83080804-83080826 CTTAACACAGCCTTTTTGCAAGG - Intergenic
980090431 4:128437343-128437365 CCTAATACTGCACTTTTCCAAGG - Intergenic
981754384 4:148125348-148125370 CCAAGCCCTGGATTTATGCAGGG + Intronic
982486078 4:155967447-155967469 CCTACCCCTGTACTTCTGCAAGG - Intergenic
982820193 4:159934911-159934933 CCTAATACTGCACTTTTCCAAGG - Intergenic
982907810 4:161099107-161099129 CCTTACCCTCTGTTTTTGCAAGG + Intergenic
982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG + Intronic
983469010 4:168133721-168133743 CCTAACCCTGCATTTTCCCTAGG + Intronic
983741927 4:171145686-171145708 CATAACCCTGCATTATTTAAGGG + Intergenic
985409769 4:189670998-189671020 CATAACAGAGCATTTTTGCAGGG + Intergenic
988210097 5:28192764-28192786 CCTCTCCCTGAATTCTTGCACGG - Intergenic
988354243 5:30152136-30152158 CCTAACACTGCATTGTAACAAGG + Intergenic
988432832 5:31139470-31139492 CCTAATCCTGTATTTTCCCAAGG + Intergenic
989558738 5:42826980-42827002 CCTATTCCTGCATCTTCGCAGGG - Intronic
991652971 5:68874943-68874965 CCTTACCCTCCATGTATGCATGG - Intergenic
991775930 5:70085640-70085662 CCTAACCCTGTATTTCTGTTAGG + Intergenic
991855218 5:70961094-70961116 CCTAACCCTGTATTTCTGTTAGG + Intergenic
993028081 5:82669090-82669112 GCTCACCCTGCATTTTTACCAGG - Intergenic
993244261 5:85431754-85431776 CCTAATACTGCACTTTTCCAAGG + Intergenic
994440619 5:99798933-99798955 CATAACCCTGCATCTTTCTACGG + Intergenic
994767446 5:103936676-103936698 CCAAAGCCTTCATTTTAGCATGG + Intergenic
995634107 5:114165895-114165917 CCTAACCCCACATTTTTCAAGGG + Intergenic
996573234 5:124955507-124955529 CCCAAATCTGCATTTTTCCAAGG - Intergenic
999498519 5:152124047-152124069 CCTGGCCAAGCATTTTTGCAGGG + Intergenic
999859510 5:155630853-155630875 CCTTACCCTACATTTCTTCATGG + Intergenic
1001088780 5:168721595-168721617 CCTACCCCTGCATTCCTGCATGG - Intronic
1001266957 5:170280620-170280642 CCTACCCCTGTAGTTTTACATGG + Intronic
1002754215 6:145559-145581 CCTAACCCTGCAGCTGTGCCGGG + Intergenic
1004030751 6:11866774-11866796 CCTAACCATGCATTTCCCCACGG + Intergenic
1004092195 6:12515101-12515123 CGTTACCCTCCATTTTTCCAAGG + Intergenic
1005058717 6:21756205-21756227 CCTAACCCTGTATTTTCCCTAGG - Intergenic
1005872090 6:29982099-29982121 CCTCACCCTGCACTATTGAATGG - Intergenic
1006275698 6:33003935-33003957 CCAAACTCTCCCTTTTTGCAGGG - Intergenic
1006446033 6:34080212-34080234 CCTCACCCTGGCTTTCTGCAGGG - Intronic
1006502491 6:34467355-34467377 CCAAACCCTGCTTTGGTGCAGGG - Intronic
1008353624 6:50524205-50524227 CCTAATCCTGCATTTCTCCTAGG + Intergenic
1008540119 6:52538894-52538916 CCTAACCCTGTATTTCTCCCAGG - Intronic
1009843893 6:69111949-69111971 ACTAACCTGGAATTTTTGCATGG + Intronic
1010993149 6:82502277-82502299 CCTAATACTGCACTTTTCCATGG - Intergenic
1013894323 6:115067047-115067069 CATAAACCTGCAGGTTTGCATGG + Intergenic
1014665403 6:124231041-124231063 TCTGCCCCTGCAGTTTTGCAGGG - Intronic
1015495779 6:133881944-133881966 CCTAACCCTAAGTTTTAGCATGG + Intergenic
1015869085 6:137757867-137757889 CCTAACCCTGTATTTCTCCTGGG - Intergenic
1016482713 6:144499087-144499109 TCTAAGCTTGCATTTCTGCAAGG - Intronic
1022291608 7:29009953-29009975 CCTAAAGATTCATTTTTGCAAGG - Intronic
1026286775 7:68970115-68970137 CCTAACCCTGCACTTCCGCTAGG - Intergenic
1028017118 7:85730091-85730113 CCTAACACTGCATTCTTCAAGGG + Intergenic
1028307736 7:89287269-89287291 CTAACCCCTGCATTTTTCCATGG + Intronic
1029049370 7:97668563-97668585 CTTAACCCTACATTTTAGAAGGG + Intergenic
1030559331 7:111064965-111064987 CCTAAACCTTCATTTCTGAAGGG - Intronic
1031050574 7:116940877-116940899 CCTAACCCCGCATTGTTCAAAGG + Intergenic
1031527038 7:122834585-122834607 CCTAATACTGCACTTTTCCAAGG + Intronic
1032143396 7:129355486-129355508 CCTAACCGTGTATTTTTCCTAGG + Intronic
1032479934 7:132238298-132238320 CCTAACCCTGTATTTCTCCTAGG + Intronic
1033181870 7:139187460-139187482 CCTAACCCTGAATATTGGGAAGG + Exonic
1036173785 8:6516328-6516350 CATAATTCTGCATTTTTGAAAGG + Intronic
1036459235 8:8937214-8937236 CCTAACCCTTGAGTTTTTCAAGG - Intergenic
1038206053 8:25466530-25466552 CCTAATCCTACATTTCCGCATGG + Intronic
1038925500 8:32135005-32135027 CCTACTCCTTGATTTTTGCATGG - Intronic
1039771390 8:40691078-40691100 CCTAACCCTGAATTTCTCCTAGG - Intronic
1040708189 8:50154271-50154293 CCTAATACTGCACTTTTCCAAGG - Intronic
1041009517 8:53528299-53528321 CCTAACCCTGTATTTTTCCTGGG + Intergenic
1042963913 8:74330639-74330661 CCTAATCCTTCATTTCTGGAAGG - Intronic
1043002677 8:74778753-74778775 CCTAACCCTGTAATTCTGCTAGG - Intronic
1044748174 8:95391316-95391338 CCTAACCCTGTATTTCTCCTAGG - Intergenic
1048472575 8:134716620-134716642 ACTAACCCAGCATTTTTGGAAGG - Intergenic
1051164479 9:14247371-14247393 CCTCTCCCTGCATTATTGGATGG - Intronic
1052970628 9:34375224-34375246 CCACACCTTGCATTCTTGCATGG - Intronic
1053430324 9:38038084-38038106 CCTAACCCTGCTTTATAGCTTGG + Intronic
1053700103 9:40681526-40681548 CCTAATACTGCACTTTTCCAAGG - Intergenic
1053797298 9:41738517-41738539 CCTATCACTGCATTTTTAAAGGG - Intergenic
1054147895 9:61576414-61576436 CCTATCACTGCATTTTTAAAGGG + Intergenic
1054185712 9:61950584-61950606 CCTATCACTGCATTTTTAAAGGG - Intergenic
1054311395 9:63480924-63480946 CCTAATACTGCACTTTTCCAAGG - Intergenic
1054410175 9:64805077-64805099 CCTAATACTGCACTTTTCCAAGG - Intergenic
1054467638 9:65507504-65507526 CCTATCACTGCATTTTTAAAGGG + Intergenic
1054652800 9:67637921-67637943 CCTATCACTGCATTTTTAAAGGG + Intergenic
1056835236 9:89949514-89949536 CCTTACTCTGCATGTTAGCAGGG + Intergenic
1058418239 9:104810505-104810527 CTTAATCATGGATTTTTGCAAGG + Intronic
1058938276 9:109789542-109789564 GCTAACCCTTCATTTTTGGAAGG + Intronic
1061716676 9:132522651-132522673 CCTAAAACTGCATTCTTGAAAGG + Intronic
1203661797 Un_KI270753v1:51433-51455 CATAACAGAGCATTTTTGCAGGG - Intergenic
1203672987 Un_KI270755v1:34482-34504 CATAACAGAGCATTTTTGCAGGG - Intergenic
1185948673 X:4406011-4406033 CCTAACCCTGGAGTTGTTCAGGG - Intergenic
1187581378 X:20610975-20610997 CCTATCCCTGATTTTATGCAAGG + Intergenic
1189045649 X:37587637-37587659 CCTAATACTGCACTTTTCCAAGG - Intronic
1189248790 X:39583832-39583854 CCTAACCCAGCTCTGTTGCAAGG + Intergenic
1190814757 X:53920119-53920141 CTTAACCCTGCATTGTTCAAAGG - Intergenic
1193914560 X:87350077-87350099 CCTAACCCTTCATTTCAGAAGGG + Intergenic
1194914245 X:99685416-99685438 CCTAAGCCTGCATGCTGGCATGG - Intergenic
1195556220 X:106227979-106228001 CCCAAACCTGCATTTTTGAAGGG + Intergenic
1195735847 X:108011697-108011719 CCTAATACTGCACTTTTCCAAGG + Intergenic
1197378840 X:125713758-125713780 CCTGACCATGCCTTCTTGCAGGG + Intergenic
1198412236 X:136382555-136382577 CCCAAGCCTTCATTTTTGAAGGG + Intronic