ID: 982964890

View in Genome Browser
Species Human (GRCh38)
Location 4:161893857-161893879
Sequence ACCAGGATATTGAATCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982964890_982964894 8 Left 982964890 4:161893857-161893879 CCCTAAAGATTCAATATCCTGGT 0: 1
1: 0
2: 1
3: 10
4: 149
Right 982964894 4:161893888-161893910 ATTTTCATTGCATTTCAGACTGG 0: 1
1: 0
2: 2
3: 28
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982964890 Original CRISPR ACCAGGATATTGAATCTTTA GGG (reversed) Intronic
900614438 1:3558458-3558480 ACCAGGAAGTTGAGTCTTTGAGG - Intronic
902741163 1:18439403-18439425 GCCAGGATATTGAAGCCTGAGGG + Intergenic
902997076 1:20234468-20234490 ACCAGTATATGGAAATTTTAAGG - Intergenic
903801757 1:25974011-25974033 ACCAGAATATAGAAGGTTTATGG + Intronic
905164614 1:36071832-36071854 AAGAGGAAATTGAAACTTTATGG + Exonic
907790846 1:57661981-57662003 CTCAGGATATTTTATCTTTACGG - Intronic
908296804 1:62720694-62720716 ATGAGGTTATTGAATTTTTAGGG - Intergenic
908826870 1:68141584-68141606 GCCAGGATATTGAAGCTCTGAGG - Intronic
908950387 1:69554577-69554599 ACCATGGTATTTAACCTTTAGGG - Intergenic
909273619 1:73656116-73656138 ATCAGTTTATTGGATCTTTAAGG - Intergenic
913990227 1:143605080-143605102 ACCAGGAGATTGTAGATTTAGGG - Intergenic
915690479 1:157684201-157684223 ACCGAAATATTGAATCTTTCAGG + Intronic
918197362 1:182234782-182234804 AACAGGATATTGGAGCTTCAAGG + Intergenic
919773369 1:201177199-201177221 GCCAGGAGATGGGATCTTTAAGG - Intergenic
920095179 1:203482084-203482106 ACTAGGTTATAGGATCTTTAAGG + Intronic
922321491 1:224492102-224492124 ACTTGAATATTGCATCTTTATGG + Intronic
924304758 1:242676033-242676055 AGCAGGATAATGTATTTTTAAGG + Intergenic
1063571818 10:7222291-7222313 ACCAGAATGTTTAATGTTTATGG - Intronic
1068041265 10:51827174-51827196 ATCAAGAAATTGAATATTTAGGG - Intronic
1069253413 10:66300325-66300347 ACCAGGATATTTAATAAATATGG - Intronic
1069701036 10:70426231-70426253 AAAAAGATATTGCATCTTTAAGG - Exonic
1071484915 10:86093098-86093120 AGCAGGCTATTGAATTTCTATGG - Intronic
1072702117 10:97650179-97650201 ATTAGGATATTGTATCTTTCTGG + Intronic
1075440044 10:122472877-122472899 AGAAGGATATGGAATTTTTATGG + Intronic
1075708389 10:124516823-124516845 ACCAGGTTACAGAGTCTTTAGGG + Intronic
1076562114 10:131373775-131373797 ACCAGGCTTCTGTATCTTTAGGG - Intergenic
1080306942 11:30846771-30846793 ACCAGGAGGTTGAGTCTTTGAGG - Intronic
1080981604 11:37413793-37413815 ACCAGAATGTGAAATCTTTAAGG + Intergenic
1081366518 11:42241818-42241840 ACCAGGAGTTTGAGTCTTTGTGG - Intergenic
1083494033 11:63034773-63034795 ACCCGTATATTGTATTTTTATGG + Intergenic
1085178270 11:74509751-74509773 TACATGATATTGATTCTTTATGG + Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1094817415 12:34201887-34201909 CCTAGAATATTGTATCTTTAAGG + Intergenic
1098021920 12:66164837-66164859 AACAGTTTATGGAATCTTTAGGG - Intronic
1098114256 12:67157707-67157729 TCCAGGATATTTAATATTAAAGG + Intergenic
1098250588 12:68565808-68565830 AACAGGATATGAAGTCTTTAGGG + Intergenic
1098711826 12:73772516-73772538 CCTAGAATATTGTATCTTTAAGG + Intergenic
1098826244 12:75301006-75301028 AATAGGTTATTTAATCTTTATGG + Intronic
1099260155 12:80369491-80369513 ATCAGGATGTTGACACTTTATGG - Intronic
1099876167 12:88408210-88408232 AGGAGGAGATTGAATCTTAAAGG - Intergenic
1109441228 13:62378054-62378076 ATAATGATATTGAATCTTGATGG - Intergenic
1111790334 13:92847170-92847192 AAAAGGATATTGATTCTCTAAGG - Intronic
1112065872 13:95792301-95792323 TCAAGAATATTGAATATTTATGG + Exonic
1113549417 13:111180774-111180796 ACCTGGAAATTTAATCTTTATGG + Intronic
1114377830 14:22168315-22168337 TCCAGGATATTGCAACTTTGGGG - Intergenic
1114405494 14:22452543-22452565 ATCAGGAAACTGAATCTTAAAGG + Intergenic
1115001568 14:28427136-28427158 CCCAGGATAGTGAATCTCTTGGG - Intergenic
1116213684 14:41981851-41981873 ACAGGCATATTGAAACTTTAAGG - Intergenic
1117494407 14:56288330-56288352 ACAAGGATAGTGAATGTTAAAGG + Intronic
1124944565 15:34252067-34252089 ACCATGGCAGTGAATCTTTATGG + Intronic
1126380265 15:48039294-48039316 ACTAGGATAATAAAACTTTATGG + Intergenic
1130099924 15:80885543-80885565 ACCAGGAAACTGACTATTTACGG + Intronic
1133892780 16:9896589-9896611 CCCAGAATATTGAATCTTAGAGG - Intronic
1141374965 16:83522206-83522228 ACATGTTTATTGAATCTTTATGG + Intronic
1142336719 16:89494078-89494100 ACCTGGAAATTAAATTTTTATGG + Intronic
1143081309 17:4383424-4383446 CCCAGGATTTTGAACCATTAAGG - Intergenic
1143342135 17:6219867-6219889 ACAAGAATATTGTTTCTTTAGGG + Intergenic
1146520550 17:33522259-33522281 AATATGATATTGAATCTTAAAGG + Intronic
1148067247 17:44880788-44880810 ACCAAGATATTTTATCTTCAAGG - Intronic
1152128089 17:78459424-78459446 ACCAGGAGACTGAAACTATAAGG + Intronic
1155742842 18:29311513-29311535 ACCAGGATAATGTACCTTCAAGG - Intergenic
1155805500 18:30166058-30166080 ACGAGGACATTAAATGTTTAAGG + Intergenic
1156776143 18:40791609-40791631 ACTATGATATTTAATCTTTATGG - Intergenic
1157380337 18:47208976-47208998 TCCAGGGTAATGGATCTTTATGG + Intergenic
1159404261 18:67978960-67978982 AACAGAATATTGAATCTGAAGGG + Intergenic
1159679135 18:71325660-71325682 ACCAGAACATGGAATCTTCAAGG + Intergenic
1160235134 18:77079424-77079446 ACCAGGACATACAATGTTTAGGG + Intronic
1160237038 18:77093934-77093956 ACCAGGTTATTGACTATTCACGG + Intronic
1165393717 19:35552604-35552626 ACCATGATAGTAAATGTTTAAGG + Intronic
927164908 2:20308380-20308402 ACCAGGATAGTCAAACTGTAAGG + Exonic
928914349 2:36455724-36455746 ATAAGGAAATAGAATCTTTAGGG + Intronic
929425734 2:41842924-41842946 ACCAGGAAATGAAATCCTTATGG + Intergenic
929471194 2:42194806-42194828 GCCAGGATCTTTAATCTTGATGG + Intronic
931047363 2:58370758-58370780 ACCAGGATATGTGATCCTTAAGG - Intergenic
931068429 2:58615395-58615417 ACCAGGAGTTTGATTCTTCATGG + Intergenic
933674622 2:85043653-85043675 AAAAGGATATTAAATCTCTAGGG - Exonic
933848268 2:86344279-86344301 TCCTGGAAATTGAGTCTTTAGGG + Intergenic
939285684 2:140126093-140126115 ATCATGATATTTAATCTTTAAGG + Intergenic
939966913 2:148619235-148619257 ACCAGGATGTTGCATTTTCATGG - Intergenic
940690266 2:156909095-156909117 ACCAGGATAGAGAGTGTTTATGG + Intergenic
943126821 2:183804176-183804198 ACCTGGATATTGGGTCTTTAGGG + Intergenic
944422978 2:199550694-199550716 AGCATGATATTGAATCCTTTAGG + Intergenic
948162520 2:235836754-235836776 ACCAGGAACTTGATTCTTCAGGG - Intronic
1168775959 20:447807-447829 TCCAGGATCTTTAATTTTTATGG - Intronic
1171043057 20:21783637-21783659 AATAGGATATTGAATGGTTATGG + Intergenic
1173344254 20:42184382-42184404 AGCAGGAAATAGAATCCTTAAGG - Intronic
1181123104 22:20685772-20685794 ACCAAGAAATTGAATCTATTTGG + Intergenic
953089330 3:39707913-39707935 ACCAGGATATTTATACTTTAGGG + Intergenic
953824717 3:46241054-46241076 ACAAGGTTATAGACTCTTTAAGG + Intronic
954549401 3:51468040-51468062 GCAAGGTTATTGTATCTTTAGGG - Intronic
957305186 3:78448749-78448771 ACCAGGAAAATAAATCTATAAGG - Intergenic
962364786 3:134771593-134771615 ACCAGGATAGTGTATGTATAAGG + Intronic
962388089 3:134949142-134949164 TCCAGGATAGTGAATCATGATGG + Intronic
964129531 3:153271556-153271578 ACCAGGAGTTAGAATCTTTTAGG - Intergenic
964261686 3:154846447-154846469 TGCAGGATATTGAATCTATCTGG + Intergenic
966026107 3:175284342-175284364 ACCAGGAAACTGAATTTTTGGGG + Intronic
966296629 3:178431653-178431675 ACCAGGATTTTTCATATTTAGGG + Intronic
966804565 3:183796928-183796950 ACGAGGATACTTAATCATTACGG + Intronic
967252344 3:187553620-187553642 AGCAGGATATGGAGTATTTAGGG - Intergenic
967654365 3:192028994-192029016 AACAGTATATTGGATGTTTATGG + Intergenic
970447361 4:16135423-16135445 CCCAGGATTTTGAGTCTTGAGGG + Intergenic
971531784 4:27697708-27697730 ACCAGTATATTTAAATTTTAAGG + Intergenic
971663678 4:29454873-29454895 ACCAGTATATTTAATTTTTATGG + Intergenic
972688194 4:41371201-41371223 AACAGCATATTGAACCATTAAGG - Intronic
974366744 4:60959950-60959972 AAAAGGATATTGATTATTTACGG + Intergenic
974403247 4:61431232-61431254 ACCACGAAATAGGATCTTTAAGG + Intronic
975102422 4:70529585-70529607 ACTTGGATATTTAATTTTTATGG + Intronic
976007845 4:80452081-80452103 ACCAGGATAATGTCTCTTTGGGG - Intronic
977427623 4:96888449-96888471 ACCTGGAAATTGAATCTCTTGGG - Intergenic
979866589 4:125762855-125762877 ACCAGTATATTGAATTCTTAGGG - Intergenic
982964890 4:161893857-161893879 ACCAGGATATTGAATCTTTAGGG - Intronic
984390585 4:179126428-179126450 ATCAGGATATGGATTCTTTTTGG + Intergenic
986752660 5:10802895-10802917 TCCAGGATATAGAATGTTAAGGG - Intergenic
987981752 5:25094889-25094911 ACCAGGATGTGGAACCTTCAGGG - Intergenic
990832226 5:59972117-59972139 GCCAGGACTTTGAATCTTGAGGG - Intronic
992960368 5:81952434-81952456 ACTAGTATATTGTATCTTTAGGG - Intergenic
996490756 5:124092967-124092989 ATTAGGAGATGGAATCTTTAGGG - Intergenic
998556357 5:143128318-143128340 AACAGGAAATAGAATCTTTCTGG + Intronic
998745684 5:145257137-145257159 AAAAGGCTATTGACTCTTTAAGG + Intergenic
1001218627 5:169879472-169879494 ACAAGGATATAGATTCTTTCTGG + Intronic
1004227206 6:13796986-13797008 ACTAGGTGATTTAATCTTTATGG + Intronic
1004348928 6:14874099-14874121 CAAAGGATTTTGAATCTTTATGG + Intergenic
1004787961 6:18990143-18990165 ACGAGGATATTTTATCCTTATGG - Intergenic
1004869165 6:19886809-19886831 ACCTGGAGAATGAATCTTTTGGG + Intergenic
1012754739 6:103213487-103213509 ACCAGAATATTAAATATGTATGG - Intergenic
1015346490 6:132165323-132165345 ACCAGGATATTGCATTGTTGAGG - Intergenic
1016238285 6:141894531-141894553 ACCTGGATATAGAATCCTTTGGG - Intergenic
1016627464 6:146189004-146189026 ACCACGTTATGGACTCTTTAAGG - Intronic
1018220345 6:161571904-161571926 ACCAGGAAATCTGATCTTTAAGG - Intronic
1020370857 7:7430670-7430692 ACTTGTATATTGAATATTTAGGG - Intronic
1024394405 7:48849128-48849150 TCCAGAAGCTTGAATCTTTAAGG - Intergenic
1024400858 7:48923513-48923535 TCCAGAAGCTTGAATCTTTAAGG + Intergenic
1027809451 7:82875997-82876019 AAGATGATATTGAATCTGTAAGG + Intronic
1028101574 7:86827176-86827198 AGAAGAATATTGTATCTTTAAGG - Intronic
1029016688 7:97322057-97322079 CCTAGAATATTGTATCTTTAAGG - Intergenic
1031856294 7:126926932-126926954 ACCAGCCTATTGGTTCTTTAAGG + Intronic
1032258600 7:130316485-130316507 AGCAGGATATGCCATCTTTAAGG - Intronic
1035296260 7:157868369-157868391 ACCAGGACATTGGATCTCTGCGG + Intronic
1035486358 7:159229340-159229362 CCCAGGATATGGAATATTTCTGG - Intergenic
1037379731 8:18272246-18272268 CCTAGAATATTGAGTCTTTAAGG - Intergenic
1041496579 8:58492318-58492340 ACCTGGATATTGAATTTCAATGG + Intronic
1041538434 8:58955273-58955295 GCCAGGATATTTAATATTTAGGG + Intronic
1041966916 8:63688809-63688831 AAAGGGATATTGTATCTTTAAGG + Intergenic
1043331982 8:79128746-79128768 ACCTGGATTTTTAATATTTATGG - Intergenic
1043946325 8:86257535-86257557 ACTAGGATATTCAATATTCAAGG + Intronic
1045105238 8:98886084-98886106 AGCAGTATAATGAATCTTTATGG + Intronic
1047816927 8:128474386-128474408 ACCAATATATTGAATTTTTTGGG + Intergenic
1050135487 9:2459298-2459320 ACCAGAATATGCAATCATTAGGG + Intergenic
1050505418 9:6342899-6342921 TCCAGGGTATTGATTCTTCAGGG - Intergenic
1057958097 9:99427879-99427901 AACAGCACATTGAATATTTATGG - Intergenic
1059209278 9:112497169-112497191 ACCAGGATATTGACTATTTATGG + Intronic
1060069286 9:120532450-120532472 GGCAAGGTATTGAATCTTTAGGG - Intronic
1186735757 X:12462418-12462440 ACTTAAATATTGAATCTTTAGGG + Intronic
1187079569 X:15972696-15972718 AAAAGGATCTTGAATCTCTATGG + Intergenic
1187611222 X:20945711-20945733 TCCTGGATTTTGAATCATTAGGG + Intergenic
1188929486 X:36089065-36089087 CCCAGGATATAAAATTTTTAAGG - Intronic
1195139647 X:101946559-101946581 AACATGATAATGAATGTTTAAGG - Intergenic
1195480971 X:105344505-105344527 ACAATGATATTGAACATTTATGG - Intronic
1195655885 X:107331263-107331285 TCCAGGATTTTGAATCTTAGAGG + Intergenic
1197918323 X:131560461-131560483 ATCAGAATATTGGGTCTTTATGG - Intergenic
1201482141 Y:14451297-14451319 ACCAGGATAATTAATATTGAGGG + Intergenic