ID: 982968692

View in Genome Browser
Species Human (GRCh38)
Location 4:161950481-161950503
Sequence CGCTGCAGTGCTTCATACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982968686_982968692 -2 Left 982968686 4:161950460-161950482 CCCATCCGCCCATATCCTTGGCG 0: 1
1: 0
2: 0
3: 0
4: 31
Right 982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
982968684_982968692 2 Left 982968684 4:161950456-161950478 CCTTCCCATCCGCCCATATCCTT 0: 1
1: 0
2: 0
3: 23
4: 264
Right 982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
982968687_982968692 -3 Left 982968687 4:161950461-161950483 CCATCCGCCCATATCCTTGGCGC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
982968688_982968692 -7 Left 982968688 4:161950465-161950487 CCGCCCATATCCTTGGCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 142
Right 982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
982968689_982968692 -10 Left 982968689 4:161950468-161950490 CCCATATCCTTGGCGCTGCAGTG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
982968683_982968692 10 Left 982968683 4:161950448-161950470 CCTCTCGACCTTCCCATCCGCCC 0: 1
1: 0
2: 2
3: 23
4: 309
Right 982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982968692 Original CRISPR CGCTGCAGTGCTTCATACTC TGG Intronic
900665265 1:3810939-3810961 TGCTCCAGGGCTTCATTCTCAGG + Intergenic
913017214 1:114751046-114751068 CGTTGAAATGCTTCATAATCGGG - Intronic
919689638 1:200517517-200517539 CCCTGCTGTGCTTCCCACTCCGG + Intergenic
922939041 1:229445376-229445398 AGCTGCAGTGAGTCATACTTTGG - Intronic
923802992 1:237228653-237228675 AGCTGCAGAGATTCAAACTCAGG - Intronic
1065982282 10:30911856-30911878 GGCTCCAGTCCTTCCTACTCTGG + Intronic
1066218388 10:33311016-33311038 GCCTGCTGTGCCTCATACTCTGG - Intronic
1069722112 10:70556438-70556460 CTCTGTAGTGCTGCCTACTCTGG - Intronic
1073881950 10:107992185-107992207 CCCTGCTGAGCTACATACTCTGG + Intergenic
1077912905 11:6588393-6588415 CAATGCAGTGCTTCATAACCTGG - Intronic
1081800499 11:45855789-45855811 CGCTGCTCTGCTTCAAACCCTGG - Intronic
1084451543 11:69241750-69241772 CGCTGCTGCGCTTCCTGCTCAGG + Intergenic
1089450121 11:118588583-118588605 GGCTGTAGTCCTTCCTACTCAGG + Intronic
1104411574 12:128562579-128562601 AGCTGCAGTGCTTCCTTCTAAGG - Intronic
1104953556 12:132453247-132453269 CGCTGCAGCCCTCCATCCTCAGG + Intergenic
1106985071 13:35336913-35336935 GGCTACAGTGCTTATTACTCAGG + Intronic
1107516095 13:41131421-41131443 CTCTGCTGTGATCCATACTCGGG - Exonic
1109316079 13:60751497-60751519 CACTGCAGTGCTTCATATTTGGG - Intergenic
1110568297 13:76978091-76978113 TGCTGCAGTCCTACCTACTCAGG + Intergenic
1113535783 13:111065217-111065239 CACTGCAGTGCTTAGTTCTCGGG + Intergenic
1114403097 14:22428108-22428130 CCCTGCAGTGTTTCATGCACTGG - Intergenic
1121954826 14:98204393-98204415 GGCTGCAGTGCCTCAGAATCAGG + Intergenic
1126111458 15:45177515-45177537 CGGAGCAGTGCTTCATAGGCTGG - Intronic
1128882642 15:71257547-71257569 TTGTGCAGTGCTCCATACTCTGG - Intronic
1129421421 15:75430323-75430345 CGCTGCTGGGCTGCATACACCGG + Exonic
1137653263 16:50138231-50138253 GGCTGCAGTGAGCCATACTCTGG - Intergenic
1148195504 17:45709968-45709990 AGCTGCAGTGCTCCGTGCTCTGG - Intergenic
1153117416 18:1676308-1676330 TGCCGCAGTGCTTGAGACTCTGG + Intergenic
1154436366 18:14345097-14345119 GCCTGCAGTGCTACCTACTCAGG + Intergenic
1155099547 18:22595753-22595775 GGGTGCAGTGGTTCATGCTCAGG + Intergenic
1155425813 18:25706256-25706278 CCCTGCTGTGGTTCACACTCTGG + Intergenic
1157241632 18:46015326-46015348 CCCTGCAGGGCTTCAGACTTTGG - Intronic
1161603797 19:5203135-5203157 GCCTGTAGTGCTACATACTCAGG + Intronic
1168468209 19:56620921-56620943 GGCTGCAGTCATTCCTACTCAGG + Intronic
925065452 2:926088-926110 AGCTGCAGTTATTCATTCTCAGG + Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
932451381 2:71812879-71812901 CACAGCAGAGCTTCAGACTCAGG + Intergenic
935216273 2:100977537-100977559 GGCTGCACTGCTTCCTACGCAGG - Intronic
940710743 2:157160537-157160559 CCCTGCAGTTCTTCATCCTAAGG + Intergenic
941347299 2:164386316-164386338 CTCTGCAGTCCTTTATTCTCTGG + Intergenic
1170596576 20:17810368-17810390 GGCTCCAGTGCTGCAGACTCTGG - Intergenic
1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG + Intergenic
1176346061 21:5748851-5748873 CACTGCAGGGCTGCATACTAAGG - Intergenic
1176352875 21:5869435-5869457 CACTGCAGGGCTGCATACTAAGG - Intergenic
1176498766 21:7575604-7575626 CACTGCAGGGCTGCATACTAAGG + Intergenic
1176540382 21:8146921-8146943 CACTGCAGGGCTGCATACTAAGG - Intergenic
1176559333 21:8329966-8329988 CACTGCAGGGCTGCATACTAAGG - Intergenic
1181584981 22:23848267-23848289 GGCATCAGTGCTTCAGACTCTGG + Intergenic
1185053957 22:48568361-48568383 CTCCTCAGTGCTTCATACCCAGG - Intronic
1203245327 22_KI270733v1_random:63347-63369 CACTGCAGGGCTGCATACTAAGG - Intergenic
950726184 3:14918524-14918546 GGCTGCAGAGCGTCATGCTCAGG - Intronic
951350475 3:21601482-21601504 CGCTCCAGTGCCTCATCCCCAGG - Intronic
956366136 3:68505083-68505105 GGCTGCAGTTTTACATACTCAGG - Intronic
958606106 3:96360502-96360524 TGCTGCAGTGTTGCATGCTCTGG + Intergenic
960877627 3:122312905-122312927 AGCTGCTGTGTTTCATAATCTGG + Intergenic
962313316 3:134341247-134341269 TGCTGCAGTGCCTCATAGTCAGG + Intergenic
975364130 4:73508700-73508722 CGCTGTAGTCCTACCTACTCAGG - Intergenic
977565276 4:98574521-98574543 AGCTGCAGTGCTTCATCCAAGGG + Intronic
978544143 4:109852302-109852324 CACAGCATTGCTCCATACTCTGG + Intronic
982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG + Intronic
983411307 4:167402151-167402173 GGCTGCAGAGCTGCATGCTCGGG - Intergenic
987191549 5:15484046-15484068 TGCTGCCGTCCTTCTTACTCTGG + Intergenic
994652412 5:102545319-102545341 TGCTGCAGCGCTCCATACACAGG + Intergenic
1001609473 5:172988667-172988689 AGCTGAAGTGCTTCACACTATGG + Intronic
1003557400 6:7152640-7152662 CCCTCCAGTGCCTCATTCTCTGG - Intronic
1003979519 6:11376913-11376935 CCCTGCTGAGCTTCAGACTCTGG + Intronic
1009060554 6:58393382-58393404 AGATGCAGTGCTCCATGCTCAGG + Intergenic
1009230362 6:61053953-61053975 AGATGCAGTGCTCCATGCTCAGG - Intergenic
1012101243 6:95087714-95087736 CCCTGCAGTGCTCCATTCTTCGG - Intergenic
1021423867 7:20476378-20476400 CTCTGCAGTGGTTCTCACTCTGG + Intergenic
1021714608 7:23450062-23450084 CACTGCATTGCTTCATGCTAAGG - Intronic
1026186411 7:68085113-68085135 GGCTGCAGTGATTCATGCTCAGG - Intergenic
1026871520 7:73855733-73855755 CGCTGCAGTCCTGCACCCTCAGG + Intergenic
1033598644 7:142873826-142873848 CTCTGCAGTGCTCCAAACTTTGG + Intronic
1034641336 7:152606151-152606173 CTCTGCATTGCTTCCTAGTCAGG + Intergenic
1038697487 8:29819191-29819213 AGCTGCTGTGTTTCTTACTCTGG - Intergenic
1049027516 8:140005378-140005400 CGCTGCTGTGCTTCATGTGCTGG - Intronic
1050818452 9:9846228-9846250 TGCTGCAGTGCTTTATGCACAGG - Intronic
1053257951 9:36635217-36635239 CACTGCATTGATTCATACTAAGG + Intronic
1056058259 9:82852232-82852254 AGCTACAGAGCTTCATACTATGG - Intergenic
1203461662 Un_GL000220v1:46419-46441 CACTGCAGGGCTGCATACTAAGG - Intergenic
1190344259 X:49322563-49322585 CCTTGCAGTGCTTCTCACTCAGG - Intronic
1190345351 X:49332107-49332129 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190346449 X:49341673-49341695 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190347697 X:49532701-49532723 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190348798 X:49542257-49542279 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190349898 X:49551813-49551835 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190351003 X:49561366-49561388 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190352104 X:49570924-49570946 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190353205 X:49580473-49580495 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190354311 X:49590020-49590042 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1190355408 X:49599544-49599566 CCTTGCAGTGCTTCTCACTCGGG - Intronic
1193306334 X:79956576-79956598 GGCTGCAGTACTTAAGACTCAGG + Intergenic
1195067702 X:101252608-101252630 CGTTGAATTGCTTCAGACTCCGG - Exonic