ID: 982971906

View in Genome Browser
Species Human (GRCh38)
Location 4:161999054-161999076
Sequence CTAGTTTTTCAGGTTTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 28, 3: 93, 4: 487}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982971900_982971906 2 Left 982971900 4:161999029-161999051 CCCCACTTTCCAGTCGTGCTCTA 0: 1
1: 0
2: 1
3: 9
4: 101
Right 982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG 0: 1
1: 0
2: 28
3: 93
4: 487
982971899_982971906 5 Left 982971899 4:161999026-161999048 CCTCCCCACTTTCCAGTCGTGCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG 0: 1
1: 0
2: 28
3: 93
4: 487
982971901_982971906 1 Left 982971901 4:161999030-161999052 CCCACTTTCCAGTCGTGCTCTAA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG 0: 1
1: 0
2: 28
3: 93
4: 487
982971902_982971906 0 Left 982971902 4:161999031-161999053 CCACTTTCCAGTCGTGCTCTAAA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG 0: 1
1: 0
2: 28
3: 93
4: 487
982971903_982971906 -7 Left 982971903 4:161999038-161999060 CCAGTCGTGCTCTAAACTAGTTT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG 0: 1
1: 0
2: 28
3: 93
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982971906 Original CRISPR CTAGTTTTTCAGGTTTCTAA GGG Intronic
900813302 1:4824716-4824738 CTATTTTTTCAGGGTTCTGTGGG + Intergenic
903309560 1:22443957-22443979 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
903399364 1:23028869-23028891 CTAGATTTTCAGCTTTTTAGGGG + Intronic
904761989 1:32811934-32811956 CTAGTTTTTTAAGTTTCTTTGGG - Intronic
906913186 1:49978876-49978898 TTATTTTTTGAGCTTTCTAATGG - Intronic
908358053 1:63341506-63341528 CTAGTTTTTTAGTTTTAAAATGG + Intergenic
909051768 1:70775437-70775459 TTAGTTTTTCAGGTTTCTTTGGG - Intergenic
909525359 1:76616030-76616052 CTGGTTCTACAGGTTTCTAGAGG + Intronic
910025746 1:82648803-82648825 CTTCTTTTTCAAGTTTCTTAAGG - Intergenic
911171744 1:94777093-94777115 CTAGTTTCTCAGGTTTAGGAGGG - Intergenic
911646103 1:100338511-100338533 CTAGTTTTTCAGGTTAACTATGG + Intergenic
911994476 1:104747093-104747115 TTGGTTTCTCAGGTTTCCAAAGG - Intergenic
912389236 1:109290437-109290459 CTATTTTCTCAGTTTTCAAAGGG + Intergenic
913401199 1:118435447-118435469 CTTCTTTTTCTGGTTTCTTAAGG + Intergenic
915074256 1:153295852-153295874 CTAGATTTTCAGGTTTCCTTTGG - Intergenic
916386425 1:164276790-164276812 GTCGTTTTTCAGTTTTCTTAAGG + Intergenic
916951135 1:169781504-169781526 CTAGTTTTTCAGGTTTACTTTGG - Intronic
916967919 1:169972018-169972040 ATAGTTTTGGAGGTTTTTAAAGG - Intronic
917198356 1:172490273-172490295 CCAGTTTTTAAGGTTTCTCTGGG + Intergenic
917489962 1:175489580-175489602 CTAGTGTTTCAGGTCTCCCAGGG - Intronic
918654696 1:187009858-187009880 CTAGTTTGTTGGGGTTCTAAAGG + Intergenic
918802539 1:188990237-188990259 CTAGTTTTTCAGATTTCTTTGGG - Intergenic
919581652 1:199383641-199383663 CTTTTTTTTCTGGTTTCTCAAGG + Intergenic
920105728 1:203552053-203552075 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
920795284 1:209131047-209131069 CTAGTTTTCCAGGTTTCCTTGGG - Intergenic
921236924 1:213141686-213141708 CTTGTTTTTCAGGTTTCTCTAGG + Intronic
921471888 1:215559417-215559439 CTTGTTTTTCTGTTCTCTAAAGG + Intergenic
921776065 1:219101651-219101673 CTAGTTTTTCAGATTTTTTTTGG - Intergenic
921901705 1:220457923-220457945 TCAGTTTTTCAGGTTTCTATGGG + Intergenic
922683640 1:227621759-227621781 TTAGTTTTTCAGGTTTCATTGGG - Intronic
922878468 1:228960416-228960438 TCAGTTTTTCAGGTTTCTCATGG + Intergenic
922895088 1:229093730-229093752 CTGGTTTTTCTGGTTTCTTTGGG - Intergenic
923076004 1:230609102-230609124 CTAGTTTTTCAGGTTTTATTGGG + Intergenic
923779482 1:237009400-237009422 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
923803866 1:237237415-237237437 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
923817603 1:237398174-237398196 TCAGTTTTTCAGGTTTCTCTGGG + Intronic
924088480 1:240478638-240478660 CTAATTTTTCATGTTTACAATGG + Intergenic
924272612 1:242349411-242349433 CTAGTTTTTCAGGTTACCTTCGG + Intronic
924904337 1:248435390-248435412 GTATTTTGTCAGCTTTCTAAAGG + Intergenic
924923551 1:248656659-248656681 GTATTTTGTCAGCTTTCTAAAGG - Intergenic
1063618684 10:7624950-7624972 CTAGTATTTGAGGTCTCCAATGG - Intronic
1063848529 10:10159768-10159790 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1063931201 10:11029965-11029987 CTCGTTTTTCAGGTCTCCTAAGG + Intronic
1063966112 10:11347174-11347196 TGAGTTTTTCAGGTTTCTTTGGG + Intergenic
1064160708 10:12943322-12943344 CTAGTTTTTCACATTTCTTCGGG - Intronic
1064184825 10:13152479-13152501 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1064520207 10:16192986-16193008 CTAGTTTTTCATGTTTATTGTGG - Intergenic
1065006682 10:21386924-21386946 CTAGTTTTTCAGGTTAATTTTGG - Intergenic
1065045567 10:21745313-21745335 CAAGTTTGGCAGGTCTCTAAGGG + Intergenic
1065114763 10:22474440-22474462 CCAGTTTGTCTGGTTTCTTAAGG + Intergenic
1065456146 10:25908653-25908675 CCAGTTTTTCAGGTTTCTTTGGG + Intergenic
1065677282 10:28190740-28190762 CTTCTTTTTCTGGTTTCCAAAGG - Intronic
1065766278 10:29033080-29033102 CTACAGTTCCAGGTTTCTAACGG - Intergenic
1065962023 10:30741474-30741496 CTATTATTTCAGGTTTCCAAAGG + Intergenic
1066192888 10:33071978-33072000 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1066974260 10:42350901-42350923 TTTGTTTTTCAGGTTTTTTAAGG - Intergenic
1068047561 10:51907110-51907132 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1068177212 10:53476955-53476977 CTAGTTTTTCAGGGTAACAATGG + Intergenic
1068197187 10:53732045-53732067 CTAGATTTTCAGGTTTATTTCGG + Intergenic
1068978044 10:63033264-63033286 CTAATTTTTCACGTTTTAAAGGG - Intergenic
1069103498 10:64354151-64354173 CTAGATTTTCAGGTGCCAAATGG + Intergenic
1069134947 10:64752358-64752380 ATAGTGTTTCAGGTTTCTTTGGG + Intergenic
1069196033 10:65552573-65552595 TTATTTTTCCAGCTTTCTAAGGG + Intergenic
1069410532 10:68148699-68148721 CTGGCTTTTCAGCTTTATAAAGG + Intronic
1070199002 10:74185355-74185377 CTATTTTTTCTGCTTTCTATTGG - Intronic
1071863026 10:89695470-89695492 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1071925772 10:90407382-90407404 CTAGTTTTTCAGGTTAGTTTTGG - Intergenic
1072036614 10:91568742-91568764 CTAGTTCTTCAGCTTGCCAATGG - Intergenic
1073543739 10:104332499-104332521 CTAGTTTTTCATCTTTCTTCAGG + Intronic
1073724578 10:106215131-106215153 CTAGCTTTTTAGGTGCCTAAGGG - Intergenic
1073786088 10:106891299-106891321 CTTTTTCTTCAGATTTCTAAGGG - Intronic
1074191088 10:111138294-111138316 ATATTTTTTCAAGTTTCTGAGGG + Intergenic
1075422503 10:122312612-122312634 CCAGTCTTTCACTTTTCTAATGG + Intronic
1075659371 10:124182672-124182694 ATTGTTTTTCAGTTTTCCAAAGG + Intergenic
1076823009 10:132951017-132951039 CCAGTTTTTCAGGTTTCCTGGGG + Intergenic
1077671343 11:4160525-4160547 CTAGCTTTTCAGGTTTCTTTGGG + Intergenic
1078046540 11:7918300-7918322 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1078208221 11:9248690-9248712 TTAGTTTTTCAGGTTTCTCTAGG + Intronic
1079365919 11:19809718-19809740 CTTGTTTTTGATGCTTCTAATGG + Intronic
1079696692 11:23490658-23490680 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1080619452 11:33974922-33974944 CTAGTTTTGGCGGTTTCTAAAGG - Intergenic
1080881689 11:36327252-36327274 CTAGTTTTTCAGGTTTACCCTGG - Intronic
1080962587 11:37177900-37177922 GTAGTTTTTCAGGTTTCTCTGGG - Intergenic
1080988810 11:37505555-37505577 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1081342710 11:41947670-41947692 CTAGGGTCTCGGGTTTCTAAAGG + Intergenic
1081796082 11:45820957-45820979 CTACTTTTTCTGTTTTCTACTGG - Intergenic
1082141154 11:48611035-48611057 TGAAGTTTTCAGGTTTCTAAGGG + Intergenic
1082568312 11:54707864-54707886 TGAAGTTTTCAGGTTTCTAAGGG + Intergenic
1082618288 11:55389507-55389529 TGAAGTTTTCAGGTTTCTAAGGG + Intergenic
1082866403 11:57903655-57903677 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1082955450 11:58865216-58865238 CTTGTATTTCAGATTTCTGATGG + Intronic
1083105194 11:60350844-60350866 CTAGTTTTTCAGGTTAATTTTGG - Intronic
1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG + Exonic
1085481434 11:76825771-76825793 CTAGTTTTTCAGGTTTTTGGGGG - Intergenic
1085489659 11:76903502-76903524 CCAGTTTTTCAGGTTTCTTTGGG - Intronic
1087226575 11:95607397-95607419 CTGATTTTTCAGGTTTCTTTGGG + Intergenic
1087256759 11:95964657-95964679 CTTGTTTGTCAGGTTTCTTTGGG + Intergenic
1087814517 11:102643762-102643784 CTAGATTATGAGTTTTCTAAAGG + Intergenic
1087941796 11:104106634-104106656 CTAGTCTTCAAGTTTTCTAAAGG - Intronic
1088561742 11:111122230-111122252 CTACTTTTTCAGGTTTCTTTGGG - Intergenic
1088693068 11:112344225-112344247 CTAGTCTTTCTTGTTCCTAAAGG + Intergenic
1089827982 11:121296168-121296190 CTAGTAGTCCAGATTTCTAATGG + Intronic
1092695749 12:11169669-11169691 TTAGTCTTTCAGTTTTCAAAGGG + Intronic
1093614389 12:21204705-21204727 TTAATTTTTCAAGATTCTAAAGG + Intronic
1093812205 12:23504780-23504802 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1093814855 12:23533384-23533406 CTGGTATTTCAGGTTTTTCAAGG + Exonic
1094212367 12:27905946-27905968 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1094216390 12:27947271-27947293 CTAGATTTTAAGCTTCCTAAAGG - Intergenic
1094425009 12:30308205-30308227 CTGGTTTCTCAGGTTTCTTTGGG + Intergenic
1094610042 12:31986652-31986674 CTAGTTGTTCATGGTACTAAGGG + Intronic
1094622657 12:32095098-32095120 TTAGCTTTTTAGGTTTCTAAAGG - Intergenic
1094763057 12:33557375-33557397 CTAGTTTGTCAGTTTTACAAAGG - Intergenic
1095332013 12:40977436-40977458 CTAGTTTTTCAGGTTACTTTTGG + Intronic
1095535187 12:43237761-43237783 CTATATTTTAAGGTTCCTAAGGG - Intergenic
1096363168 12:51005891-51005913 CTAGTTTTTCAGGTTTTCTTTGG - Intronic
1096413417 12:51392708-51392730 CTAATTGTTCAGGGTTCTCAAGG - Intronic
1097400121 12:59118371-59118393 CTAGTTTTTCAGGTTTTATCAGG - Intergenic
1097553192 12:61101540-61101562 CTTGTTTTTCAAGTTTCTTGAGG + Intergenic
1098628599 12:72702262-72702284 GTAATTTTTCTGGTATCTAAAGG + Intergenic
1099182919 12:79488269-79488291 CTACTTTTTAAGGTCTTTAAGGG - Intergenic
1099261214 12:80385257-80385279 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1099274802 12:80561213-80561235 CTAATTTTTCAGGTCTCTCCTGG - Intronic
1099308059 12:80982925-80982947 CTAGTTTTTCAGGTTAATTTTGG - Intronic
1100099220 12:91082096-91082118 CTATTTGTTCAGGTTCCTCATGG + Intergenic
1100252747 12:92846279-92846301 TTACTTTTTCTGCTTTCTAATGG - Intronic
1101609421 12:106277040-106277062 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
1101920960 12:108932625-108932647 TCAGTTTTTCAGGTTTCTCTGGG - Intronic
1102444424 12:112990892-112990914 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1106015975 13:25869565-25869587 CTTGTTTTTCAGGTATATGAAGG + Intronic
1106363668 13:29056603-29056625 CTAGGTTTTCTAGTTTGTAAGGG + Intronic
1106434509 13:29712018-29712040 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1107072894 13:36291051-36291073 CTAGTTTGTCAGGTTTCTTTGGG - Intronic
1107290353 13:38845438-38845460 CTAGTTTTACAAGATTCAAAAGG - Intronic
1108535972 13:51379365-51379387 CTAGTTCTTGATGGTTCTAATGG - Intronic
1108883245 13:55147428-55147450 TTAGGTTTTCAGGTTTCTCAGGG - Intergenic
1108920101 13:55662306-55662328 TCAGTTTTTCAGGTTTCTTTGGG + Intergenic
1109664841 13:65520607-65520629 CTACCTTTTCAGGTTCTTAAAGG + Intergenic
1110167284 13:72458739-72458761 CTGGTTCTACAAGTTTCTAATGG - Intergenic
1110269084 13:73572916-73572938 CTAGTTTTTCAGAATGTTAATGG - Intergenic
1110982419 13:81917989-81918011 CTAGTTTTTCAGGTTTGCTTTGG - Intergenic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1111107992 13:83670852-83670874 CTATTTTTTAATGTTACTAAGGG + Intergenic
1111160373 13:84386622-84386644 CTTGTTTTTCTAGTTTCTTAAGG - Intergenic
1111172196 13:84541962-84541984 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1111328814 13:86735141-86735163 CTAGGTTTTCAAGTTTGTTAGGG - Intergenic
1111559646 13:89928739-89928761 CCAGCTTTTCAGGTTTCTCTGGG - Intergenic
1111895941 13:94141572-94141594 TTCGTTTTTCAGGTTTCTCTGGG + Intronic
1112185964 13:97127978-97128000 CTAGATTTTCAGGTTTCTGTAGG + Intergenic
1113158459 13:107352299-107352321 TAAGTTTTTCAGGTTTCTCTGGG + Intronic
1113423693 13:110189848-110189870 CTAGTATTTCAGGGCTCTGAGGG + Intronic
1113710419 13:112460680-112460702 CTATTTTTTCAAGTTTCTTAAGG + Intergenic
1113918664 13:113890867-113890889 TTAGTTTTTCAGGTTTCTCTGGG - Intergenic
1114188914 14:20426164-20426186 TAAGATTTTCATGTTTCTAAGGG - Intergenic
1114338399 14:21716514-21716536 CAAGTCTTTCAGATTTCTCATGG - Intergenic
1114441627 14:22752861-22752883 CTAGTTTTTCAGGTTAATTCTGG + Intergenic
1114892012 14:26936768-26936790 CTAGTTTTTCAGGTTGCTTTGGG + Intergenic
1115167122 14:30461511-30461533 TAAGTTTTTCTGGTTTCCAAAGG - Intergenic
1115381647 14:32746345-32746367 CTGGTTTTTCAGGGTTCAAAGGG + Intronic
1115476379 14:33817759-33817781 CTGGTTTTTCTGGTTTCTACTGG - Intergenic
1115532733 14:34342106-34342128 TCAGTTTTTCAGGTTTCTTTGGG - Intronic
1115933544 14:38526116-38526138 CTAGTTTTTCAGGTTAACTATGG + Intergenic
1116602914 14:46950212-46950234 CTAATTTTTCAGATTTCGCATGG + Intronic
1116735371 14:48683977-48683999 CTAATTTTTCATGTTGCTACTGG + Intergenic
1116978561 14:51142858-51142880 CTAGTTTTTCAGGTTTCCTTGGG + Intergenic
1118158611 14:63266386-63266408 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1118670141 14:68116368-68116390 CTAGGTTTTCAAGTTGGTAATGG + Intronic
1118778624 14:68990885-68990907 CTGTTTTTTCAGGCTTCTCAGGG + Intergenic
1119356922 14:74015133-74015155 ATATTTATTCAGGATTCTAAAGG + Intronic
1119576916 14:75732643-75732665 CCTGTTTATTAGGTTTCTAAGGG + Intronic
1119958268 14:78824249-78824271 TTAGTTTTTAAGGTTTCTCTGGG + Intronic
1120262911 14:82210731-82210753 CTAGTTTTTCTAGTTTCTGAAGG + Intergenic
1120618996 14:86739677-86739699 CTACTTGTTCAGGTTTCTTTGGG + Intergenic
1121381820 14:93477805-93477827 CTAGTTTTTCGAGATTATAATGG + Intronic
1121425020 14:93844398-93844420 CTAGTTTTTCAGGCTTATTTTGG + Intergenic
1121986310 14:98509914-98509936 CTGATTTTGCAGGATTCTAAAGG - Intergenic
1123850803 15:24354584-24354606 TTAGTTTTTCAGGTTGCTTTGGG + Intergenic
1124958340 15:34374991-34375013 CTAGTTTTTCAGGTTAATTTTGG - Intergenic
1125341325 15:38678430-38678452 CTAGTTTTTCAGGTTTACTTGGG - Intergenic
1126350335 15:47739238-47739260 CTAGTTTTTCAGCTTCCCAAAGG - Intronic
1127402022 15:58598225-58598247 CTAGTTTTCTAAGTTTTTAAAGG + Intronic
1128265658 15:66264847-66264869 CTAGTTTTTTGGGATTTTAACGG + Intergenic
1128775217 15:70315254-70315276 TTAGTTTTTCAAGTTTCTTTGGG + Intergenic
1129046490 15:72739152-72739174 CTAGCTATTCAGGTATCTGATGG - Intergenic
1129363017 15:75036377-75036399 CTAGTTTTTCTGGTTTTAGAGGG - Intronic
1131464961 15:92647486-92647508 TTAGTTTTTCAGGTTTCTCTGGG - Intronic
1132263599 15:100446785-100446807 CTAGATTTTCAGGTTTACATTGG - Intronic
1133394107 16:5432189-5432211 TGTGTTTTTCAGATTTCTAATGG - Intergenic
1133562130 16:6960140-6960162 TAAGTTTTTTGGGTTTCTAAAGG + Intronic
1134171493 16:11973266-11973288 CTAGTTTTTCAGGTTGCCTTTGG + Intronic
1134338686 16:13325439-13325461 CTAGTTTTTCAGGTTTCTTTAGG + Intergenic
1134887877 16:17810386-17810408 TTTGTTTTTCAGGTTTTTACTGG - Intergenic
1134911427 16:18030170-18030192 CTAATTTTCCAGGTTTTTGAGGG - Intergenic
1135838895 16:25855692-25855714 TTAGTTTTTCAGGTTACTCTGGG + Intronic
1137372319 16:47919032-47919054 TTAGTTTTTCACGTTTCTCTGGG + Intergenic
1138031316 16:53561753-53561775 TCAGTTTTTCGGGTTTCTCAGGG + Intergenic
1139102564 16:63786287-63786309 TTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1140782372 16:78308318-78308340 CTAGTTTTTCAGGTTTATTTCGG - Intronic
1141411906 16:83840848-83840870 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1141914749 16:87087595-87087617 TTAGTTTTTCAGGTTGCTATGGG - Intronic
1142177930 16:88653398-88653420 CTGCTTTTCCAGGTTTCTGAAGG - Exonic
1142325769 16:89413676-89413698 CTAGGTTTGCAGGTCTGTAAGGG - Intronic
1145223653 17:21109555-21109577 TCAGTTTTTCAGGTTTCTCTAGG - Intergenic
1146099399 17:29964858-29964880 CTACTTTTTCGAGTTTCTTAAGG + Intronic
1146471189 17:33126403-33126425 CTACTTTTTCATGTGTCGAATGG + Intronic
1146592072 17:34136008-34136030 CTAGTTTTTCAGGTTTCTCCAGG - Intronic
1147941962 17:44055188-44055210 ATAGTTTTTCTGGCTTCTAGAGG - Intronic
1148951849 17:51320234-51320256 CTAGTTTTTCAGGTTTATTTTGG + Intergenic
1149021044 17:51964834-51964856 CTTGTTTTTCAGGTTTCTCTAGG - Intronic
1149124919 17:53217245-53217267 TTTGTTTTTCAGATTTTTAATGG + Intergenic
1149215346 17:54347470-54347492 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1150370736 17:64635519-64635541 GTAGATTTTCAGGTTGCTAGGGG - Intronic
1154024336 18:10693121-10693143 ATAGTTTTTCATATTTTTAATGG + Intronic
1154113541 18:11591118-11591140 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1155128780 18:22908511-22908533 CTTCTTTTTCTGGTTTCTTAAGG + Intronic
1155720433 18:29004577-29004599 CTAGTTTTAAACTTTTCTAATGG + Intergenic
1156076826 18:33288597-33288619 CTACTTCTTAAGGTTTTTAAGGG - Intronic
1156082614 18:33356558-33356580 CTAGCTTTTTAGGTTTCTTTGGG - Intronic
1156581086 18:38376065-38376087 CTATTTTTTCAAGTTTCTTATGG - Intergenic
1157163351 18:45335705-45335727 GAAGTTTTTCAGGTTTCTTAGGG - Intronic
1157163594 18:45337541-45337563 TCAGTTTTTCAGGTTTCTCTGGG - Intronic
1158164945 18:54529709-54529731 GTAGTTTTTCAGGGTTCTTTGGG + Intergenic
1158569291 18:58583363-58583385 CTAGTTTTTTAGGTTTCTTAGGG + Intronic
1158797697 18:60867599-60867621 CTAGTTTTTCTGGATACTTATGG - Intergenic
1158851403 18:61498583-61498605 CTTGTGTTTCAGGTGTCAAATGG - Intronic
1159208009 18:65279181-65279203 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1159323547 18:66886900-66886922 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1159650183 18:70969340-70969362 CTGGTTCTTCAGTTTTCAAATGG - Intergenic
1159992711 18:74928798-74928820 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1160292987 18:77610906-77610928 CTAGGTGTGCAGGTTTCCAAAGG - Intergenic
1162204349 19:9044581-9044603 CTAGTTTTTCAGGTTCCTTTGGG - Intergenic
1162305259 19:9869064-9869086 CTGATTGTTCAGGTTTTTAAGGG - Intronic
1163088162 19:14998132-14998154 CTAGTTTTTCAGGTTAATTTTGG - Intronic
1164431260 19:28190851-28190873 CTAGTTTTTTGGGTTTCTTTGGG - Intergenic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1166236107 19:41458191-41458213 TTAGTTTTTCAGGTTTGCAGGGG - Intergenic
1166271715 19:41718550-41718572 CTTGTTTTTCTGATTTCTCATGG + Intronic
1166431115 19:42728931-42728953 CTTGTTTTTCTGTTTTCTCATGG - Intronic
1166451559 19:42906730-42906752 CTTGTTTTTCTGTTTTCTCATGG - Intronic
1166469952 19:43071508-43071530 CTTGTTTTTCTGTTTTCTCATGG - Intronic
1166481088 19:43175023-43175045 CTTGTTTTTCTGTTTTCTCATGG - Intronic
1166490671 19:43258010-43258032 CTTGTTTTTCTGTTTTCTTATGG - Intronic
1166913490 19:46177867-46177889 TTAGTTTTTCAGATTTCTCTTGG - Intergenic
1168495252 19:56842413-56842435 TTTGTTTTTCAGGTTCCCAAGGG + Intergenic
925042740 2:746160-746182 TTAGTTTTTAAGATTTCTGAAGG - Intergenic
926779897 2:16460912-16460934 ATGGTCTTTCAGATTTCTAAGGG - Intergenic
927444835 2:23150054-23150076 CTAATTTTCCAGGATGCTAATGG + Intergenic
927950381 2:27164259-27164281 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929324961 2:40598670-40598692 CATGTTTTTCTGGTTTCTTACGG - Intronic
930093557 2:47549278-47549300 CTTGTTTTTAAGCTTTTTAAAGG - Intronic
930285447 2:49422334-49422356 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
930459665 2:51656795-51656817 CTATTTTCTCAGGTTTATAATGG - Intergenic
930961511 2:57267336-57267358 CTAGGTTTTCAGGCATCTGATGG + Intergenic
931197892 2:60070227-60070249 CCAGCTTCTCACGTTTCTAAAGG - Intergenic
931203116 2:60120297-60120319 CTTGTCTATGAGGTTTCTAAGGG - Intergenic
931749057 2:65314971-65314993 TTAGATTTGCAGGTTTCTAGAGG - Intronic
932267741 2:70382857-70382879 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
932360010 2:71097050-71097072 CTTCTTTTTCTGGTTTTTAAAGG - Intergenic
932691635 2:73918570-73918592 CTAGTTTTCCAGTTTTGGAAGGG - Intronic
933432353 2:82199299-82199321 CTTGTTTTTCAGGTTTCTTTGGG - Intergenic
934881371 2:97983375-97983397 CTAGTTTTTCAGGTCTCTTCGGG + Intronic
936008143 2:108908133-108908155 CTTGTTTTTCAGGTGTTTACTGG + Intronic
936035029 2:109104391-109104413 ACAGTTTTTCAGGTTTCTTTGGG + Intergenic
936281975 2:111149533-111149555 CAACTTATTCAGGTTTCTCAGGG + Intronic
936800839 2:116263237-116263259 CTTATTTTTCAAGTTTCTTAGGG - Intergenic
936965721 2:118125955-118125977 CTAGTTTTGCAGGTTTCCTGTGG - Intergenic
937621204 2:123989456-123989478 CTAATTTTTCAGTTTTCTAATGG - Intergenic
937760502 2:125596480-125596502 CTAGTTTTTCTAGATTCTCAAGG - Intergenic
938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG + Intergenic
939560974 2:143731298-143731320 TTAGATTTTCTGGTTTCCAATGG + Intronic
940406917 2:153314851-153314873 CCTTTTTTTCAGGTTTCTTAAGG - Intergenic
941428836 2:165386698-165386720 ATTTTTTTTAAGGTTTCTAATGG + Intronic
941907898 2:170734750-170734772 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
942294097 2:174500826-174500848 GTAGTTTTTCAGGTTTCTTTGGG + Intergenic
942339169 2:174925152-174925174 TCAGTTTTTCAGGTTTCTTTGGG - Intronic
942586707 2:177487843-177487865 ATAGTTTTTCAGTTTAGTAAAGG - Intronic
943581537 2:189689303-189689325 TTAGTTTTTAAGGTTTCTTTGGG + Intronic
943663542 2:190585028-190585050 CTGGTTATCCAGGTTTCTCAGGG - Intergenic
944646453 2:201785411-201785433 TCAGTTTTTAAGGTTTCTCAGGG + Intergenic
945323648 2:208456934-208456956 CAAGTTTTTCATGTTTTTAGAGG + Intronic
946799482 2:223396850-223396872 CTAGTTTTTCAGATTTTTAAAGG + Intergenic
947267078 2:228294676-228294698 CTATTTTTTCTGCTTTCTTATGG - Intergenic
947618179 2:231571903-231571925 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1168906970 20:1412987-1413009 CTTGTTTTTCTAGTTTCTAGAGG - Intergenic
1169302806 20:4459226-4459248 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1169650719 20:7864302-7864324 CCAGTTTTTCAAGTTCCTTATGG - Intergenic
1170879812 20:20286833-20286855 CTTGTTTTTCTGGGTTTTAAAGG - Intronic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1173535352 20:43806726-43806748 CTTATTTTTCTGGTTTCTTAAGG + Intergenic
1173546544 20:43902445-43902467 CTGGTTTTGGAGGTCTCTAAGGG - Intergenic
1174119364 20:48250739-48250761 TCAGTTTTTCAGGTTTCTCTAGG - Intergenic
1174323410 20:49760238-49760260 CTAGTTTTTCAGGTTTTCTTTGG - Intergenic
1174435112 20:50500811-50500833 CTAGTTTTTCAAGTTTTTGAAGG - Intergenic
1175151044 20:56934668-56934690 CTTGTTTTTGAGATTTCTCATGG + Intergenic
1175614474 20:60383325-60383347 CTAGTTTATGAGATTTTTAATGG - Intergenic
1175770142 20:61618328-61618350 GTTGTTTTTCAGGTTTCTCTGGG + Intronic
1176738111 21:10571436-10571458 CTTGCTTTTCACGTTTCTTATGG - Intronic
1177191848 21:17860898-17860920 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1177306635 21:19326970-19326992 CTACTTTTTCAGTTTTATATAGG + Intergenic
1177387180 21:20423676-20423698 CCAGTCTTTCAGGTTTGGAATGG + Intergenic
1177450720 21:21261792-21261814 CTTGTTTTTCTAGTTTCTTAAGG - Intronic
1177519642 21:22202435-22202457 TTAGTTATCCAAGTTTCTAAGGG + Intergenic
1177595855 21:23241373-23241395 CTAGTCTTTCTAGTTTCTAGAGG + Intergenic
1178327710 21:31659238-31659260 CTTGTTTTTTAGTTTTCTGAGGG - Intergenic
1178968912 21:37153546-37153568 ATAGTTTTTCTGTTTTTTAAAGG - Intronic
1180558133 22:16593759-16593781 CTTGTGTATCAGGTTTCTTAGGG + Intergenic
1182800997 22:33031798-33031820 TCAGTTTTTCAGGTTTCTCTGGG - Intronic
1184624947 22:45718868-45718890 CTAGGTTTGTAGGTTTCTAATGG + Intronic
949095096 3:76465-76487 TTAGTTTTTCAGTTTTCTCTGGG - Intergenic
950917363 3:16659553-16659575 CTAGTTTTTCAGGTTTACTTTGG - Intronic
950920651 3:16690686-16690708 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
952161973 3:30703001-30703023 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
952628730 3:35439509-35439531 CCAGTTTTTCAGGTTTCTCTGGG + Intergenic
953178155 3:40570835-40570857 CCAGTTTTTCAGGTTTCTTTGGG + Intronic
953855491 3:46496663-46496685 TTAGTTTTTCAGGTTTCTCAGGG + Intergenic
954720350 3:52556697-52556719 ATGGTTTTACAGGTTTCTTAGGG - Intronic
954995547 3:54878127-54878149 CTAGTGTTGCAGTTTTCTATCGG + Intronic
955208535 3:56919116-56919138 CCAGCTTTTCGGGTTCCTAAGGG + Intronic
955909768 3:63847893-63847915 CTAGTTTTTCAGGTTTACTTTGG - Intronic
956508510 3:69969092-69969114 CTACTTTTACATGTTTTTAAGGG - Intergenic
956831591 3:73054383-73054405 CTAGTATCACAGGATTCTAATGG + Intronic
957483906 3:80832982-80833004 CTAGTTTTTCAGGTTTAGATGGG - Intergenic
957601702 3:82343821-82343843 TTAGTTTTTGAGCCTTCTAATGG - Intergenic
957653542 3:83039717-83039739 GTAGTGTTTCAGGCTTCTTAGGG - Intergenic
958044266 3:88265167-88265189 CTGATTTTTCTGATTTCTAATGG - Intergenic
959343091 3:105156589-105156611 TCAGTTTTTCAGGTTTCTCTAGG - Intergenic
959376595 3:105595217-105595239 CTAGCTTTTCAGGTTTCTTTTGG + Intergenic
959399134 3:105877916-105877938 CTAGTTAGTCAGTTTCCTAAAGG + Intergenic
959499163 3:107085620-107085642 CCAGTTTTTAAGGTTTCTCTGGG + Intergenic
959862796 3:111235073-111235095 CTAGCTTTTCAGGTTTCTTGGGG + Intronic
959947877 3:112146373-112146395 CTTGTTTTTCTAGTTCCTAAGGG + Intronic
960244596 3:115386349-115386371 CTAGTTTCTCACATTTCTTATGG - Intergenic
960425988 3:117508498-117508520 CCAGTTTTTCATGTTTCTTTGGG + Intergenic
960830197 3:121838215-121838237 CAATTTTTTCAGGTTTACAATGG - Intronic
961130223 3:124459159-124459181 CTAGGTATTCAGATTTCAAAAGG + Intronic
961470859 3:127111092-127111114 CTAGGTTTTCAGGTTTCTTTGGG - Intergenic
963294500 3:143530624-143530646 TTTGTTTTTCAGATTTCTGATGG - Intronic
963390845 3:144662064-144662086 CTAGTTTTCCAGTGTTTTAATGG + Intergenic
963842174 3:150119019-150119041 CTAGCTTTTCAGGTTTCTTTGGG - Intergenic
963910538 3:150813861-150813883 TTAGTTTTTCAGGTTTTTGGGGG + Intergenic
964222806 3:154366137-154366159 TCAGTTTTTCAGGTTTCTCTAGG - Intronic
964260954 3:154836034-154836056 TCAGTTTTTCAGGTTTCTTTGGG + Intergenic
964528307 3:157639607-157639629 CATGTTTTTCAATTTTCTAATGG + Intronic
964854988 3:161137114-161137136 ATAGTTTTTCAGCTTTCTCTGGG + Intronic
964856117 3:161147696-161147718 CTAGTTTTTCAGGTTAACATTGG + Intronic
964880038 3:161413162-161413184 CTAGTTTATCATGTATCCAAAGG + Intergenic
965185308 3:165455093-165455115 CTAGGGTCTCAGGTTTCTATGGG + Intergenic
965320442 3:167247146-167247168 CTAGTGTCTCAGGTTTTTATAGG - Intronic
965584379 3:170303350-170303372 CTGGTTTTTCAGTTTTTAAAAGG + Exonic
965765489 3:172125776-172125798 CTACTTTTCCTGTTTTCTAAGGG + Intronic
966614544 3:181899182-181899204 CTAGTTTTTCAGTATTCTTAAGG - Intergenic
966900041 3:184475409-184475431 CTAGTTTTTATTGTTTCCAATGG + Intronic
967195625 3:187023080-187023102 TCAGTTTTTCAGGTTTCTCTGGG + Intronic
967543244 3:190693552-190693574 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
969346312 4:6572555-6572577 CTAGTTTTTTGGGTTTCTTTGGG - Intergenic
969629101 4:8325070-8325092 CTTGTTTTTCAAGTGACTAAGGG + Intergenic
969634350 4:8357909-8357931 CTGGTTTTTCAGGTTTCTTTGGG - Intergenic
969661796 4:8534386-8534408 CTAGTTTTTCAGGTTTACGTTGG - Intergenic
970276233 4:14404119-14404141 TTAGTTTTTCAGGTTTCATTGGG + Intergenic
971008399 4:22402500-22402522 CTAATTATTTATGTTTCTAATGG + Intronic
971249851 4:24965718-24965740 CTTGTTTTTCGAGTTTCTCAAGG - Intronic
971539937 4:27803380-27803402 CTAGCTTCTCAGGTTTCCCACGG + Intergenic
972139135 4:35934387-35934409 CTTATTTATAAGGTTTCTAATGG + Intergenic
973133167 4:46673283-46673305 CTTGAGTTTCAGGTTTCTCAGGG - Intergenic
973169130 4:47117125-47117147 GTAGTTTCTGAGCTTTCTAAGGG - Intronic
973975277 4:56256840-56256862 CTAGTTTTTCAGGTTTACTTTGG - Intronic
973983712 4:56328760-56328782 CTAATTTTTCAGACTTCGAAGGG + Intergenic
974027290 4:56744863-56744885 CAAGTTTTTAAGGTTTCTCTGGG - Intergenic
974537999 4:63194055-63194077 CTATTTTTTTTAGTTTCTAATGG + Intergenic
974633903 4:64533490-64533512 CTACTTTTTCAGGTTTTTTGGGG + Intergenic
974772812 4:66437600-66437622 CTAGTTTTTCAGATTTCTTTGGG - Intergenic
975435522 4:74346480-74346502 TTAGTTTTTCAGTTTTCTCTGGG + Intergenic
976344870 4:83989385-83989407 TCAGTGTTTCAGGTTTCTCAGGG - Intergenic
977578202 4:98697077-98697099 CTAGTTTTTCAGGTTTCTTTAGG - Intergenic
978131529 4:105203869-105203891 CTGTTTTTTAATGTTTCTAAAGG + Intronic
978942842 4:114458136-114458158 GTAGTTTTTCAGGTTCCTTTGGG + Intergenic
978963149 4:114708867-114708889 GTAGTTTTTCCAGTTTCTAGTGG + Intergenic
979449569 4:120854367-120854389 CTTTTTTTTCTGGATTCTAATGG - Intronic
979591022 4:122480382-122480404 TTAGTTTTTAAGGTTTCTCTGGG + Intergenic
979648007 4:123094349-123094371 TTAGTTTTTTAGGTTTCTGTAGG + Intronic
980032714 4:127848944-127848966 CTTGTTTTTCAGGTTCCTTGAGG - Intergenic
980625527 4:135370879-135370901 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
980756262 4:137166323-137166345 CAAGTCATTCAGGTTTCAAATGG - Intergenic
980782822 4:137513881-137513903 CTTCTTTTTCAGTTTTCTAAGGG - Intergenic
980875859 4:138661413-138661435 TTTGTATTTCAGGTTTATAAAGG + Intergenic
981089215 4:140715278-140715300 CTAGTTTTTCAGGTTTACTTTGG + Intronic
981738772 4:147981121-147981143 CTTGTTTTTCTGGTTTCTTTAGG + Intronic
981805617 4:148711798-148711820 TTAGTTTTTCAGGTTTCCTTTGG + Intergenic
982370777 4:154630604-154630626 CTAGGTTTTGAGGATTCAAAGGG + Intronic
982792617 4:159610690-159610712 TTGTTTTTTCAGGTTTCTCAAGG + Intergenic
982863888 4:160487052-160487074 CCAGTTTTTCAGGTTTTCACGGG + Intergenic
982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG + Intronic
983730234 4:170983959-170983981 CTAGATTTTAAGATTTTTAAGGG - Intergenic
983778852 4:171643024-171643046 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
984086763 4:175323153-175323175 GTAGTTTCTCAGGTTTCTTTGGG - Intergenic
984443845 4:179808237-179808259 CTTGTTTTTCTAGTTTCTCAAGG - Intergenic
984498057 4:180523447-180523469 CTAGTTTTTCTCTTTTCTGAAGG + Intergenic
984500229 4:180549430-180549452 GTACTTTTTCAGTTTTATAAGGG + Intergenic
984651008 4:182270555-182270577 TCAGTTTTTCAGGTTTCTCCAGG + Intronic
984707437 4:182857922-182857944 TCAGTTTTTAAGGTTTCTCAGGG - Intergenic
985810846 5:2083407-2083429 CTAGTTTTTCGTATTTTTAATGG - Intergenic
986925646 5:12745437-12745459 ATAGTTTTTCAGCTTTGCAATGG - Intergenic
987144894 5:14982520-14982542 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
987144960 5:14982930-14982952 CTAGTTTTTCGGGTTTCTTTGGG - Intergenic
987265831 5:16254068-16254090 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
987378324 5:17258806-17258828 CTGGTTTTTTAGGTAGCTAAAGG + Intronic
988158294 5:27484058-27484080 CTTGCATTTCAGGCTTCTAAAGG - Intergenic
988717016 5:33838250-33838272 ATAGTTTGTTAGATTTCTAATGG + Intronic
988731612 5:33978088-33978110 CTAGGTTTTCAGGTTTCTTTGGG - Intronic
988866237 5:35338253-35338275 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
990123058 5:52479861-52479883 CTAGTTGTTCTGGTTTCTTTGGG - Intergenic
990604209 5:57392175-57392197 CTACTTTTTCTAGTTTCTTAAGG + Intergenic
990749455 5:58998169-58998191 CTATTTTTACATGTTTTTAAAGG + Intronic
991465304 5:66906280-66906302 CTAGTTTTTCAGGTTTACTTTGG + Intronic
991773020 5:70057518-70057540 CTAGTTTTTCAGGTTAATTTTGG - Intronic
991852313 5:70932942-70932964 CTAGTTTTTCAGGTTAATTTTGG - Intronic
992110490 5:73488081-73488103 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
992306922 5:75450215-75450237 CTAGTTTTTCAGGTTTAGTTGGG - Intronic
994859242 5:105167270-105167292 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
994887335 5:105581996-105582018 ATAGTTTTCCAGCTTTCTCATGG - Intergenic
995454123 5:112333992-112334014 CTAGTTTTTCAGGTTTCACTGGG - Intronic
995477308 5:112561270-112561292 CTAGTTTTTCAGGTTTAGTTGGG - Intergenic
995579407 5:113579811-113579833 CTTGTTTTTCAGTTTTCTTGGGG + Intronic
995586771 5:113656219-113656241 TCAGTTTTTCAGGTTTCTTGGGG + Intergenic
995722827 5:115154267-115154289 CTTGCTTTTCTGGTTTCTAGAGG - Intronic
995754935 5:115492865-115492887 ATAGCTTTCCATGTTTCTAAAGG - Intergenic
995924958 5:117360318-117360340 CTCGTTTTTAAACTTTCTAAAGG - Intergenic
996431286 5:123380997-123381019 CTGGTTATTCAAGTTTTTAATGG + Intronic
998479545 5:142451357-142451379 CTAGCTTTTCAGCTTTGTGAGGG + Intergenic
998998128 5:147889127-147889149 CTATTTTTTCAGCTTTTCAAAGG - Intronic
999376568 5:151090872-151090894 ATAGTTTTTCAGATGTCTACTGG + Intronic
1000546300 5:162607360-162607382 GAAGTTTGTCAGCTTTCTAAAGG + Intergenic
1000806555 5:165800573-165800595 CTACTTTTTCAGGATTCTTTTGG - Intergenic
1000867236 5:166528781-166528803 CTGGTTGTACATGTTTCTAAGGG + Intergenic
1001177383 5:169483305-169483327 CTTATTTTTCAAGTTTCTAATGG + Intergenic
1001282640 5:170398183-170398205 CCAGTTTTTCAGGTTACTTTTGG + Intronic
1001374071 5:171237925-171237947 CTAGATTTTCAGCTTTTTGAGGG + Intronic
1002798142 6:493272-493294 ACTGTTTTTCAGGCTTCTAAGGG - Intronic
1002869614 6:1155188-1155210 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1003191236 6:3876855-3876877 ATAGGTTTTAAGATTTCTAAGGG + Intergenic
1003239053 6:4326567-4326589 CTTGCTTTTCAGGCTTATAAGGG + Intergenic
1003951137 6:11116889-11116911 CTTCTTTTTCAAGTTTCTTATGG + Intronic
1004041081 6:11976291-11976313 CTATTTTTCCAGGTTTATTATGG - Intergenic
1005517306 6:26566935-26566957 GTAGTTTTTCAGCTTTGTAAGGG + Intergenic
1006035275 6:31206687-31206709 CTTTTTTTTCAGGTTAGTAATGG - Intergenic
1006498000 6:34437772-34437794 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1006541325 6:34742550-34742572 CTATTTTTTCAGATGTATAAAGG + Intergenic
1006579970 6:35071557-35071579 CCTGTTTTTCAGGTTTCTGTGGG + Intronic
1008192505 6:48476506-48476528 ATAGTTTTTCAGGTATTCAAAGG - Intergenic
1008375404 6:50785821-50785843 CCAGTTCTTCAGCTTTCTACAGG + Intergenic
1008473794 6:51914336-51914358 CTAGTTTTACTGCTTTCTAGAGG - Intronic
1010371384 6:75112498-75112520 TTTTTTTTTCAGGTTTCTAAAGG - Intronic
1010433197 6:75801630-75801652 TTATTTTTTCAGATTTCCAAGGG - Intronic
1011241992 6:85282171-85282193 CTATCTTTTCACATTTCTAAAGG + Intergenic
1011326352 6:86152787-86152809 CTAGGTTCTCAGGTTTCTATAGG + Intergenic
1011400465 6:86955934-86955956 CTAGTTTTTCAGGTTTACTTTGG - Intronic
1013831084 6:114273601-114273623 CTAGGTTTTCACTTTCCTAACGG - Intronic
1013880187 6:114889206-114889228 CTAGTATTTAAGGTCTATAAAGG + Intergenic
1014241827 6:119026531-119026553 CTATTTTTTCAGGTTTCTTTGGG - Intronic
1014252375 6:119127989-119128011 CTAGTGTTTCAGGTTTCTTTGGG - Intronic
1014467526 6:121774697-121774719 CTAGTTTTTTAAATTTCTAAAGG + Intergenic
1014538470 6:122645868-122645890 TGAGTTTTTCAGTTTTCAAAAGG - Intronic
1014615081 6:123588451-123588473 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1014786003 6:125620008-125620030 ATACTGTTTCAGGTTTCTTAAGG + Intergenic
1016233967 6:141839014-141839036 CTAAGTTTTCAAGTTTTTAAGGG + Intergenic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1016495604 6:144658422-144658444 TTAGTTTTTCTGGTTTTAAATGG + Intronic
1018279315 6:162167787-162167809 CTAGACTTTGAGGTTTGTAAAGG + Intronic
1018673800 6:166201766-166201788 CTTGTTTTTCAGGTTAGTAAAGG + Intergenic
1018991840 6:168679705-168679727 CTAGTTTGTCAGGTTTCTTTGGG - Intergenic
1020451028 7:8320564-8320586 TTAGTTTTTAAGGTTTCTGTGGG + Intergenic
1021403338 7:20235829-20235851 CTAGTTGTTCAGGTTTTCTAGGG - Intergenic
1021641753 7:22744420-22744442 CTAGTTTTTCAGGTTTCTTCGGG + Intergenic
1021708725 7:23394082-23394104 TTAGTGTTATAGGTTTCTAAAGG + Intronic
1022091698 7:27111766-27111788 CTGGTTTTTCAGGTTCCTGGAGG - Intronic
1022158461 7:27683674-27683696 CTAGTCTTTTAGGTCTCAAAAGG - Intergenic
1022171073 7:27832155-27832177 CAAGATTTTCAGCTTTTTAAAGG + Exonic
1022296713 7:29062477-29062499 CAAGTTTTGCAGGTTTATAATGG + Intronic
1022616619 7:31937526-31937548 CTAGTTCTTCAGGTTTCTTTGGG + Intronic
1023067711 7:36395300-36395322 CTAACTTTTCTTGTTTCTAAAGG + Intronic
1023232287 7:38047212-38047234 CTTGTTTTTCTAGTTCCTAAAGG + Intergenic
1023731218 7:43194161-43194183 CTGGTTTTTCAGGTTTCTTTGGG + Intronic
1024005097 7:45219571-45219593 CTTTTTTTTCTGGTTTCTATTGG + Intergenic
1024196045 7:47059906-47059928 CTTGATTTTCAGGTTTGTAAGGG + Intergenic
1024484364 7:49900257-49900279 CTTCTTTTTCTAGTTTCTAAAGG - Intronic
1025033602 7:55576608-55576630 CTAGTTTTTTAGGTTTCCTTTGG + Intergenic
1025164559 7:56701462-56701484 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1025705718 7:63860614-63860636 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1026563035 7:71466237-71466259 CTAGTTTTTCAGGTTTCCTTGGG - Intronic
1027025187 7:74846677-74846699 TTAATTTTTCAGGTTTTAAAGGG + Intronic
1027062576 7:75097441-75097463 TTAATTTTTCAGGTTTTAAAGGG - Intronic
1027533886 7:79370940-79370962 CCAGTTTTTCAGGGATCTCATGG + Intronic
1027601611 7:80246998-80247020 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1027620670 7:80481332-80481354 CTAGTTTTTCAGGTTTACTTTGG - Intronic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1028784194 7:94773696-94773718 CTAGTCTTCCAGGTCTGTAATGG - Intergenic
1030549780 7:110943914-110943936 TTAGTTTTTCATGTTGCTGAAGG - Intronic
1030700574 7:112634538-112634560 CTAATTTTTCATTTTTATAAAGG + Intergenic
1030783854 7:113636124-113636146 TTAGTTGTTCAGGTTTCTGGGGG - Intergenic
1031188839 7:118519830-118519852 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1031225941 7:119037927-119037949 CTATTTCCTCAGCTTTCTAATGG - Intergenic
1031417000 7:121507079-121507101 GTACTTTTTCAGGTCTCCAAGGG + Intergenic
1031810467 7:126361465-126361487 CCAGTTTTTCAGGTTTTGAGGGG + Intergenic
1032660669 7:133980226-133980248 CTAGTTGTTCATGTGGCTAATGG - Intronic
1032674251 7:134113818-134113840 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1034619180 7:152444238-152444260 CTTGTGTATCAGGTTTCTTAGGG - Intergenic
1035075090 7:156172287-156172309 CTAGTTTTTCAGGTCTCCTGAGG + Intergenic
1035476489 7:159147855-159147877 CTCGTTTTTCAGGTTTCTTTGGG - Intergenic
1036005574 8:4658659-4658681 GTAGTTTTTAATTTTTCTAACGG - Intronic
1036057906 8:5280309-5280331 CTAGTTTCTTAGGTTTCTTTTGG - Intergenic
1037120115 8:15273974-15273996 CTATTCTTTCAGGTTTGTTAAGG - Intergenic
1037209696 8:16371516-16371538 CTAGTTTTTCAGGTTTTCTTTGG + Intronic
1037288376 8:17324805-17324827 CTAGATTTTCAGGTTATTATTGG + Intronic
1037379858 8:18274009-18274031 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1037390976 8:18391458-18391480 TTAGTTTTCCAGGTTTCTCTGGG - Intronic
1037598839 8:20376578-20376600 CTAGTTTTTCAGGTTTATTGGGG - Intergenic
1037929176 8:22867479-22867501 CTAGATTTTCAGGTTGCGGAAGG + Intronic
1038381278 8:27096641-27096663 CTATTTTATAAGGTTTATAAGGG + Intergenic
1039332299 8:36551648-36551670 CTACTTTTTCTGCTTTCTACTGG - Intergenic
1039380829 8:37083435-37083457 CAAATTTTTCATGTTTGTAAAGG + Intergenic
1039501926 8:38024716-38024738 CTAGTTTTTCAGGTTAACATTGG - Intergenic
1039736496 8:40338255-40338277 CTAATTTTTCAGGCTTCTTTGGG + Intergenic
1039799472 8:40941785-40941807 CTAGTTTTTTAGGTTTCTTTGGG + Intergenic
1039829186 8:41199536-41199558 CTAGTTTTTCAGGGCTCTTCTGG - Intergenic
1041144379 8:54857997-54858019 CTAGATTTTGAGTTTTTTAAAGG + Intergenic
1041425810 8:57719084-57719106 CTAGGTTACCAGTTTTCTAAGGG - Intergenic
1041782377 8:61591162-61591184 ACAATTTTTCATGTTTCTAAAGG + Intronic
1042639274 8:70915305-70915327 CTAGTTTGTTAGTTTTCCAAAGG + Intergenic
1042877451 8:73452141-73452163 CTAGTATTTCAGGTTCCCAGGGG + Intronic
1043291253 8:78604332-78604354 CTAGCTTTTTAAGCTTCTAAAGG - Exonic
1043624041 8:82232573-82232595 CTAGTTTTTCAGGTTAATGTTGG - Intergenic
1043803321 8:84639519-84639541 CTGGTTTTTTAGGTTTCTTTGGG + Intronic
1043924535 8:86022014-86022036 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1043930651 8:86087617-86087639 CCACTTCTTCAGGTTGCTAAAGG + Intronic
1043946151 8:86255112-86255134 TTAGTTTTTCAGGATTCTTTGGG - Intronic
1044188180 8:89281556-89281578 CTAGTTTTTCAGGTTTCCTCTGG - Intergenic
1044396585 8:91720474-91720496 CTAGTTTTTCAGGTTTTCTTTGG + Intergenic
1044522629 8:93216969-93216991 CTAGTGTTTCAGGTTTATTTTGG + Intergenic
1044774260 8:95671291-95671313 CTTGTTTTTAAGCTTTCTTAAGG - Intergenic
1045099773 8:98832661-98832683 TTAGTTTTTAAGGTTTCTCTGGG + Intronic
1045681045 8:104660486-104660508 CTAGTTTTTAAGTTCTATAAAGG + Intronic
1046147833 8:110185093-110185115 CTTGATTTTCTGGTTTCTTAAGG + Intergenic
1046196353 8:110867630-110867652 CTAAAATTTCAGATTTCTAAAGG + Intergenic
1046279915 8:112013262-112013284 CTAGCTTTTACAGTTTCTAAAGG - Intergenic
1046458031 8:114494187-114494209 CTAGAATTTAAGGTTTCAAAGGG - Intergenic
1047544827 8:125805336-125805358 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1048621347 8:136136155-136136177 CTAGTTTATCAGGTTTGCATTGG - Intergenic
1048632583 8:136260303-136260325 CTCGTTTTTCAGGCTACTACAGG - Intergenic
1049959837 9:727918-727940 CTAGTTTTTCAGGTTTACTATGG - Intronic
1050771373 9:9205526-9205548 TTTGTTTTTCAAGTTTCTATGGG - Intronic
1050772325 9:9217626-9217648 AAAGTTTCTCTGGTTTCTAAGGG + Intronic
1051679412 9:19592196-19592218 TTAGTTTTTCAGCTTGGTAAAGG + Intronic
1051713146 9:19953555-19953577 CTAGTGTCTCAGTTTTCTCAAGG + Intergenic
1052223864 9:26060423-26060445 CTAGTTTTTCAGTTTTTTGGAGG + Intergenic
1052392039 9:27891105-27891127 CTAGTTTTTCAGGCTACAAGAGG + Intergenic
1052952116 9:34220896-34220918 CTTGTTTTTCAGGTTCTAAATGG + Exonic
1053082241 9:35186014-35186036 GTAGTTTTTCAGGTTTCTTTGGG - Intronic
1053393648 9:37753433-37753455 CTAGTTTTTAAGGTTTCCTTCGG + Intronic
1053404153 9:37856449-37856471 CAAGGTTTTCAGTTTTCTAATGG + Intronic
1053539398 9:38958221-38958243 CTAGCTTTTTAGGTTTCTTTGGG - Intergenic
1054626743 9:67405697-67405719 CTAGCTTTTCAGGTTTCTTTGGG + Intergenic
1054752879 9:68926354-68926376 ATAATTTTTCAGGTTTTTAATGG + Intronic
1055013782 9:71594357-71594379 CTAGATTTTCAGGTTTATTTTGG - Intergenic
1055108737 9:72538963-72538985 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1055214470 9:73841429-73841451 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1055233598 9:74091720-74091742 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1055649615 9:78394489-78394511 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1056701569 9:88915592-88915614 CTAGTATTTCAGGTTTATTATGG + Intergenic
1056739638 9:89243286-89243308 TTAGTTTTTCAGGTTTCCCTTGG + Intergenic
1057981561 9:99669128-99669150 CTAGCTTTTCAGGTTTCTTTGGG + Intergenic
1185435954 X:95234-95256 GTTGTTTTTCAGGTTTCTTTGGG + Intergenic
1185444304 X:249788-249810 GTTGTTTTTCAGGTTTCTTTGGG - Intergenic
1185503348 X:615394-615416 CTAGTTTTTCTGGTGTCTTTGGG - Intergenic
1185929655 X:4188116-4188138 CTAGCTATTCAGGTTTTTGAGGG - Intergenic
1185971628 X:4671522-4671544 CCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1186034204 X:5403233-5403255 TTAGTTTTTCAGGTTTCTCTGGG + Intergenic
1186085622 X:5987635-5987657 CTATTATTTGTGGTTTCTAATGG + Intronic
1186175964 X:6926086-6926108 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1186340786 X:8644275-8644297 CTAATTTTTCAGGTTTATTTGGG - Intronic
1186811908 X:13198603-13198625 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1186972693 X:14865422-14865444 CTTGTTTTCCAGTTGTCTAAAGG - Exonic
1187057440 X:15754149-15754171 CTAGTTCTTCAGGTTTCTTTGGG + Intronic
1187349252 X:18496920-18496942 TCAGTTTTTCAGGTTTCTCTGGG + Intronic
1187429804 X:19211685-19211707 CAGCTTTTTCAGGTTTCTAGTGG - Intergenic
1188537389 X:31212749-31212771 CTAGGTTTTCTGATTTCTCATGG + Intronic
1189164516 X:38847384-38847406 CTGCTTTATCAGGTTTCCAAAGG + Intergenic
1189411313 X:40774648-40774670 CTAGTTTTACACTTTTCTACAGG - Intergenic
1189868013 X:45351767-45351789 CTAGTTTTTCAGCTGTTTCAGGG - Intergenic
1189957418 X:46289365-46289387 CTAGTTTTTGAGGTTTCTTTGGG + Intergenic
1190538689 X:51455695-51455717 TTAGTTTTTCAGGTTGCTCTGGG + Intergenic
1190589307 X:51982442-51982464 CTTGTTTCTCCAGTTTCTAAAGG + Intergenic
1192708693 X:73556766-73556788 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1193019171 X:76771151-76771173 CTTGTTTTTCTAGTTTCTAGAGG - Intergenic
1193185441 X:78507139-78507161 ACAGTTTTTCAGCTTTCTCATGG - Intergenic
1193585767 X:83319202-83319224 TTAGTTTTTCAGGCTTCTAGGGG + Intergenic
1194129748 X:90066777-90066799 TTAGTTTTTCAGATTTCTTTGGG + Intergenic
1194177742 X:90672696-90672718 CTTGTTTTTCTGGTTTCTTCAGG - Intergenic
1194483076 X:94451129-94451151 GTAGTTTTTCAGGATTCTTTGGG + Intergenic
1194518547 X:94890167-94890189 CTAGTTCTTCAGGTTCCAGATGG - Intergenic
1194940244 X:100000575-100000597 CTTTTTTTTCAGTTTTCTGAAGG + Intergenic
1195099114 X:101537238-101537260 CTGGTTTTTCAGTTTTTAAAAGG - Intergenic
1195463484 X:105154251-105154273 TTAGTTTTTCAGGTTTCTTTGGG + Intronic
1195686762 X:107594482-107594504 CTTGTTTTTCTGGTTTCTTAAGG + Intronic
1195898921 X:109777256-109777278 CTAGTCTATCAGGGTTCTAAAGG + Intergenic
1198447141 X:136728456-136728478 CCCCTTTTTCAAGTTTCTAAGGG - Intronic
1199170534 X:144729886-144729908 GTAGTTTTTCAGGTTCCTTTTGG - Intergenic
1200369423 X:155707051-155707073 CTTGTTTTTCTAGTTTCTGAAGG + Intergenic
1200524412 Y:4254845-4254867 CTTGTTTTTCTGGTTTCTTCAGG - Intergenic
1201594075 Y:15647881-15647903 TGAGCTTTTCAGGTTTGTAATGG + Intergenic