ID: 982974183

View in Genome Browser
Species Human (GRCh38)
Location 4:162032458-162032480
Sequence GAAAATGCACAGAAATAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 612}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982974183 Original CRISPR GAAAATGCACAGAAATAGTT TGG Intronic
900930895 1:5736804-5736826 AAAAATACATAGAAATAGCTGGG - Intergenic
902688446 1:18094515-18094537 CAGAATACACAGAAACAGTTTGG - Intergenic
903399844 1:23034204-23034226 AAAAATGCATGGAAATATTTAGG - Intronic
903411090 1:23143423-23143445 GGAAATGCACATACTTAGTTTGG + Intronic
903924435 1:26821650-26821672 AAAAATACAAAAAAATAGTTGGG - Intergenic
905469682 1:38182460-38182482 AAAAATGCAAACAATTAGTTGGG + Intergenic
905783170 1:40730652-40730674 GGAGATGCACAGGAATGGTTGGG + Intronic
906046088 1:42832001-42832023 GCAAATGCAAAGACATGGTTTGG - Intronic
906976547 1:50580093-50580115 TAAACTGCACAGAAACATTTAGG - Intronic
907509011 1:54944661-54944683 AAAAATGCAAATAATTAGTTAGG + Intergenic
907705199 1:56826774-56826796 GAAGATCCTCAGAAATACTTGGG - Intergenic
907713811 1:56909174-56909196 ACATATGGACAGAAATAGTTTGG - Intronic
907717850 1:56944240-56944262 GAAAATGCATATAAAAAGTAAGG + Intronic
908675053 1:66594269-66594291 GGAAATACAAAGAAATAATTTGG - Intronic
909066089 1:70937533-70937555 GAAAATCAAAAGGAATAGTTAGG + Intronic
909221762 1:72972124-72972146 AAAAATGCAGAAAAATAGCTGGG - Intergenic
909273468 1:73654510-73654532 GAACATGCACTGATATGGTTTGG + Intergenic
909528555 1:76655201-76655223 GAAAAAATACAGAAATAATTTGG - Intergenic
911262582 1:95703081-95703103 GAAAATGCAGAGGAAAAATTTGG + Intergenic
911370017 1:96985560-96985582 GAAAATGAACTAATATAGTTAGG - Intergenic
911373746 1:97025072-97025094 GAAAAGGCACAGACATGGCTGGG + Intergenic
911659018 1:100478869-100478891 GAAAATGCCTAGGAATTGTTGGG + Intronic
911844096 1:102726797-102726819 GAAAATACAAAGAAGTGGTTTGG - Intergenic
912040946 1:105389575-105389597 GGAGATGCAGAGAAATATTTGGG + Intergenic
912155036 1:106907829-106907851 GAAAAAGGAAACAAATAGTTTGG - Intergenic
913066599 1:115261404-115261426 GAAAATGCACAGGAGCATTTGGG + Intergenic
913299126 1:117352226-117352248 AAAAATACACAGAATTAGCTGGG - Intergenic
913503884 1:119497934-119497956 GGAAAAGCACAGTATTAGTTAGG - Intergenic
913578422 1:120200555-120200577 GAAAATACAAAGAATTAGCTGGG + Intergenic
913629750 1:120697796-120697818 GAAAATACAAAGAATTAGCTGGG - Intergenic
914252667 1:145934581-145934603 AAAAAAACACACAAATAGTTTGG + Exonic
914560345 1:148811995-148812017 GAAAATACAAAGAATTAGCTGGG + Intronic
914612488 1:149318220-149318242 GAAAATACAAAGAATTAGCTGGG - Intergenic
914735148 1:150409299-150409321 GTAAATGCACAGCATTAGGTAGG - Intronic
914891357 1:151626539-151626561 GAAAATGCAAAAAATTAGCTGGG + Intronic
914986650 1:152462997-152463019 GAAAATGCAAAGAATTGGTCGGG - Intergenic
915412032 1:155708863-155708885 AAAAATGCAAAAAAATAGCTAGG - Intronic
916597838 1:166262745-166262767 GAAAATACAAAAAAATAGCTGGG + Intergenic
916919975 1:169455066-169455088 GAAAATGAATAGAAAAAATTTGG - Intronic
918606296 1:186430916-186430938 GTATATGCACAGTAATATTTAGG - Intergenic
918821195 1:189256345-189256367 GAAAATCTACACTAATAGTTTGG + Intergenic
919876509 1:201873144-201873166 GAAAATGGACAAAAATAGGCCGG + Intronic
920813992 1:209313933-209313955 GTAAATACAGAGAGATAGTTAGG + Intergenic
920887858 1:209949702-209949724 GAAAATGAACAGGAATACTAAGG - Intronic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
922305803 1:224343513-224343535 AAAAATGCAAAAAATTAGTTGGG - Intergenic
922524421 1:226288923-226288945 ATAAATGCACAAAAATATTTAGG + Intronic
922864391 1:228847211-228847233 GAGCCTGCACAGAAATAGGTAGG - Intergenic
923172103 1:231427261-231427283 GAAAATGCACAAGATAAGTTTGG - Intergenic
923239190 1:232063833-232063855 TAAAATTCAGAGAAAAAGTTGGG + Intergenic
923600551 1:235399112-235399134 AAAAATACAAAAAAATAGTTGGG - Intronic
924160312 1:241224579-241224601 GAAAATCTACAGCAATAATTTGG + Intronic
1063642598 10:7845475-7845497 TAAAATGCACTGAAATGATTTGG + Intronic
1065493948 10:26310116-26310138 TAAAATGCACACAAACAGGTAGG - Intergenic
1065636068 10:27735866-27735888 GAAATTCCACAGAAATTGTAGGG + Intronic
1066368726 10:34801028-34801050 AAAATTGCAGAGAAATAATTCGG - Intronic
1066790397 10:39056023-39056045 GAATATGCAAAGAAACATTTTGG + Intergenic
1066791961 10:39075161-39075183 GAACATGCAAAGAAATATTTGGG + Intergenic
1066795718 10:39118286-39118308 GAATCTGCAAAGAAATATTTTGG + Intergenic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1066810902 10:39334048-39334070 GAATCTGCAAAGCAATAGTTTGG - Intergenic
1067376113 10:45728575-45728597 AAAAATACACAAAATTAGTTGGG + Intronic
1067471106 10:46538729-46538751 GAAATTGTACAGAGATAGTTTGG + Intergenic
1067883813 10:50069263-50069285 AAAAATACACAAAATTAGTTGGG + Intronic
1068070082 10:52184050-52184072 GGGAATGCACTGAAATAGTGAGG - Intronic
1068104502 10:52596975-52596997 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1068106502 10:52623536-52623558 GAACATGCAGAGAAATAGCAAGG + Intergenic
1070147327 10:73784518-73784540 GAAAATGCAAAGAATTAGCCAGG - Intergenic
1071016915 10:81008330-81008352 GAAAATGCATAAAAACAGTAAGG + Intergenic
1071871245 10:89796865-89796887 GCAAATGCACTAAGATAGTTTGG - Intergenic
1072335850 10:94397542-94397564 GAAAATACAGAAAAATAGCTGGG - Intergenic
1072472745 10:95729004-95729026 GAAAATACTAAGAAAAAGTTAGG - Intronic
1072631261 10:97148203-97148225 GAAAATGCACATAAAGTTTTTGG + Intronic
1072673605 10:97449687-97449709 GGAAATGCAAAAAAATAGCTGGG - Intronic
1073549486 10:104384664-104384686 GAAAATGCAGAGAAAAGGTTTGG + Intronic
1073845489 10:107549041-107549063 GGAAATTCACAGAAATCTTTTGG - Intergenic
1074073549 10:110098788-110098810 GAAAATACAAAAAATTAGTTGGG - Intronic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075216712 10:120542858-120542880 GCAAATGCACAGAATAATTTTGG - Intronic
1075535406 10:123267549-123267571 GAAAATGCACAATATTAGCTTGG - Intergenic
1076485671 10:130815141-130815163 AAAAATACAAAAAAATAGTTGGG + Intergenic
1078295408 11:10063516-10063538 AAAAATACAAAGAAATAGCTGGG - Intronic
1079837558 11:25352341-25352363 GAAAAGGTACAGAAAAAATTGGG + Intergenic
1079861601 11:25679206-25679228 AGAAATGCAAAGAAACAGTTGGG - Intergenic
1080055050 11:27898227-27898249 GAAAATGGACAGAGTTAGTAAGG + Intergenic
1080131741 11:28803451-28803473 GAAAAGGCAAGGAAATAGATTGG - Intergenic
1080391278 11:31849233-31849255 GAAAATGCATAGTGGTAGTTTGG - Intronic
1080739733 11:35052574-35052596 GGGGATGCACAGAAATAGATGGG + Intergenic
1080828743 11:35871557-35871579 GTAAATGCACAGACACATTTTGG - Intergenic
1081080863 11:38737576-38737598 GAAAAAGAACAGAAATACCTGGG - Intergenic
1081353648 11:42086702-42086724 GAAAATGCACACGAATAGAGAGG - Intergenic
1081455885 11:43222237-43222259 GGAAAGGCACAGACATAGTGGGG - Intergenic
1081532325 11:43970636-43970658 AAACATGCAGAGAAATGGTTGGG - Intergenic
1081954514 11:47078674-47078696 GAAAATGCAGAGAAATATTAAGG + Intronic
1082296815 11:50450434-50450456 GAAACTGCAAAGGAATATTTGGG + Intergenic
1082302531 11:50526612-50526634 GAATATGCGAAGAAATATTTGGG + Intergenic
1082558162 11:54587168-54587190 GGAAATGCACAGTATTAGTGTGG + Intergenic
1082571989 11:54753525-54753547 GAAACTGCAAAGGAATATTTGGG + Intergenic
1082585745 11:54937420-54937442 GAAACTGCACAGTTATATTTGGG - Intergenic
1084921152 11:72471077-72471099 GGAAATGCACAGACTTATTTAGG + Intergenic
1085100115 11:73793685-73793707 GAGTATGCAGAGAAATAGTATGG + Intronic
1085577286 11:77617550-77617572 AAAAATGTACAGACATTGTTCGG + Intronic
1085801756 11:79596252-79596274 GAAAATACAAAAAAATAGCTGGG + Intergenic
1086188729 11:84052138-84052160 GAAAATGCACATATATGTTTGGG - Intronic
1086663252 11:89448138-89448160 GAAAATGAATAGAAATTTTTAGG - Intronic
1087262239 11:96023808-96023830 GAAAATGCAAGGAGAAAGTTAGG + Intronic
1088390847 11:109313541-109313563 TAAAATGCACTGAAATATTATGG - Intergenic
1089858960 11:121572067-121572089 GAAATTGCCCAGACATAATTAGG + Intronic
1090779912 11:129998733-129998755 GGAAAGGCACAGAAAAATTTTGG + Intronic
1091261511 11:134238284-134238306 GAAAATGCAGAGACATGTTTAGG + Intronic
1091774770 12:3177296-3177318 AAAAATACACAGAATTAGCTGGG - Intronic
1091866271 12:3839584-3839606 GAAAATCCACAGGAATGGGTAGG + Intronic
1092137044 12:6156829-6156851 AAAAATACAAAAAAATAGTTGGG - Intergenic
1092326807 12:7541259-7541281 GAAAATGTACATATTTAGTTAGG - Intergenic
1093040034 12:14367537-14367559 GAACATACACATAAATATTTCGG + Intronic
1093054381 12:14540547-14540569 GAAAATACACAGAAACAAGTTGG + Intronic
1093100886 12:15027838-15027860 GAAAATTCACAAAGATATTTGGG - Intergenic
1093424769 12:19016001-19016023 AAAAATACACAGAATTAGCTGGG + Intergenic
1093845519 12:23965912-23965934 AAAAATGCAAAGAAATGGCTGGG - Intergenic
1094867524 12:34554963-34554985 GAATATGCGAAGAAATATTTGGG - Intergenic
1094876975 12:34659246-34659268 GAATATGCAAAGAGATACTTTGG + Intergenic
1094877195 12:34662820-34662842 GAATCTGCAAAGAAATATTTGGG + Intergenic
1095428771 12:42110158-42110180 GAATATTCTCAGAAATATTTAGG - Intronic
1096909502 12:54968057-54968079 AAAAATTCATAGAAGTAGTTGGG + Intronic
1097098432 12:56568941-56568963 GAAAATGCAAAGTAATAATCTGG - Intronic
1097426516 12:59452142-59452164 GAAAATTAATAGAAATATTTTGG + Intergenic
1098155420 12:67592958-67592980 GAGGAGGCATAGAAATAGTTTGG - Intergenic
1099106505 12:78503409-78503431 GAAAAGGAACAGAAGTAATTGGG - Intergenic
1099590560 12:84582824-84582846 GAAAATGCCTAGAAATCTTTTGG - Intergenic
1099906072 12:88771804-88771826 GAAGGTGCTCAAAAATAGTTTGG - Intergenic
1101023800 12:100580521-100580543 AAAAATGCCCAGAAAATGTTTGG - Intronic
1102087541 12:110155469-110155491 GAAAATACAAAAAATTAGTTGGG - Intronic
1102090749 12:110185344-110185366 AAAAATACAAAAAAATAGTTGGG - Intronic
1102288255 12:111677256-111677278 GAAAAGACCCAGAAATAGATTGG - Intronic
1102541710 12:113624552-113624574 GAATATCCACATAAATTGTTTGG + Intergenic
1102791489 12:115650012-115650034 GGAGATGAAAAGAAATAGTTTGG + Intergenic
1103144013 12:118578325-118578347 GTAATTGCAAAGAAATAGTATGG - Intergenic
1103178853 12:118890024-118890046 GAAAATACAAAAAAATAGCTGGG - Intergenic
1104426291 12:128681138-128681160 AAAAATGCAAAGAATTAGCTGGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105005755 12:132719619-132719641 AAAAATGCACAGAAATAACCGGG + Intronic
1105777084 13:23672872-23672894 GAGAATGTTCAGAAATAGTTGGG - Intronic
1106428956 13:29661067-29661089 GAAATTGCTCAGAAAGTGTTGGG + Intergenic
1106609105 13:31261564-31261586 GAATATACACACAAATAGCTAGG - Intronic
1107228074 13:38075220-38075242 GAAGATAAACAGAAATATTTTGG + Intergenic
1108096793 13:46910585-46910607 GAAAAATAACAGAAATAGATGGG - Intergenic
1108195577 13:47991319-47991341 GAACATGCCCAGGAATAGTGAGG - Intronic
1108390380 13:49941611-49941633 GAAAATGCAAAAAACTACTTTGG - Intergenic
1108443657 13:50483564-50483586 GAAAATGTACAGGGATAGTCTGG + Intronic
1108537923 13:51405405-51405427 GAAAATGCAGAGGAATAATTAGG + Intronic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109165712 13:59032084-59032106 GAAAATACACACAAATATTTAGG - Intergenic
1109488655 13:63064337-63064359 GAATTTTCACAGAAATAGATCGG + Intergenic
1109553034 13:63930915-63930937 AAAAATGCACAGAAACACTCTGG + Intergenic
1109665298 13:65527423-65527445 AAAAATGCACAGCCATAGTGTGG - Intergenic
1110099423 13:71577976-71577998 TAAAATGCATAGAAATACTGTGG - Intronic
1110346510 13:74453888-74453910 GAAATTTTACAGAATTAGTTTGG + Intergenic
1110393191 13:74999843-74999865 GACAATGCACAGAAAGTGTCTGG + Intergenic
1111132648 13:83996895-83996917 GAATATAAACAGAGATAGTTGGG - Intergenic
1111133673 13:84010230-84010252 GAAAATGTACAGTAAAAGTACGG - Intergenic
1111299285 13:86325634-86325656 GTCAATGCACAGAAATTGCTAGG + Intergenic
1111623927 13:90759107-90759129 GAAAAAGAACAGAAATACTTGGG - Intergenic
1111894855 13:94128763-94128785 GCAAATGCACACAAATGATTAGG - Intronic
1112023144 13:95389523-95389545 GAAAAAGCTCAGAAAAAGTCAGG - Intergenic
1112827742 13:103411572-103411594 TCAAATTCACAGAAATAGTGAGG - Intergenic
1113395560 13:109944305-109944327 GAAAATCTACAGTAATACTTGGG - Intergenic
1113410852 13:110088020-110088042 GAAAATTCACTCAAATAATTTGG + Intergenic
1113475564 13:110578337-110578359 GGATATGCACAGAAAAAGTATGG + Intergenic
1113731272 13:112643184-112643206 AAAAATAAACATAAATAGTTAGG - Intergenic
1114056303 14:18969969-18969991 GAAAATACAAAGAATTAGCTGGG + Intronic
1114106248 14:19431757-19431779 GAAAATACAAAGAATTAGCTGGG - Intronic
1114338961 14:21723333-21723355 GAAAATGCACAGAAAAAGAAAGG - Intergenic
1115138081 14:30135628-30135650 GACAATGGCCAGAAAAAGTTTGG - Intronic
1115981960 14:39062891-39062913 CAAAATCCATAGAAAAAGTTTGG - Intronic
1116117652 14:40677200-40677222 AAAAATACAGATAAATAGTTGGG + Intergenic
1116516409 14:45811920-45811942 GCAAATGCACAGAAATTGAGAGG - Intergenic
1116741535 14:48761227-48761249 GAAAATGCAGAAAATTAGTTGGG - Intergenic
1118132863 14:62986904-62986926 GAGAATGAATAGAAATATTTGGG + Intronic
1118972187 14:70646208-70646230 GGAAATTCAAAGAAATAGGTAGG + Intronic
1119532620 14:75373645-75373667 GAAAATGAACAGAAATTGCTAGG - Intergenic
1119876093 14:78060668-78060690 CAAAATCCACAGAAAAAGTCTGG - Intergenic
1120056582 14:79931172-79931194 GAATATCCACAGTAATATTTTGG + Intergenic
1121118349 14:91359296-91359318 AAAAATACAAAGAATTAGTTGGG - Intronic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121558839 14:94859322-94859344 TAAAATACACTGAAATAGCTGGG + Intergenic
1123143220 14:106103673-106103695 AAAAATGCAGAGAATTAGTAAGG - Intergenic
1123220118 14:106847802-106847824 CAAAATGCAGGGAAATAGTAAGG - Intergenic
1202893993 14_KI270722v1_random:185431-185453 CATAATTCACAGAAAGAGTTGGG - Intergenic
1123487001 15:20749659-20749681 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1123543488 15:21318717-21318739 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1124192013 15:27587793-27587815 GAATATTCAGAGAAACAGTTTGG + Intergenic
1125013395 15:34905598-34905620 GAAAATGCATAGTGATATTTAGG - Intronic
1125464316 15:39935278-39935300 GATAATATTCAGAAATAGTTTGG - Intronic
1126964596 15:54037078-54037100 GAAAGCACACAGAAATACTTAGG - Intronic
1127159244 15:56164156-56164178 GAAAGTTCACAGAAAAACTTAGG - Intronic
1127987301 15:64083781-64083803 GAAAATACAAAAAATTAGTTGGG + Intronic
1128063947 15:64752769-64752791 AAAAATGCAAAGAATTAGCTGGG - Intronic
1129260481 15:74364616-74364638 CAAAATGCACAGACAAAGTAAGG - Intronic
1129922868 15:79335386-79335408 GTAAATGTCAAGAAATAGTTTGG - Intronic
1130770886 15:86922449-86922471 AAAAATACACAGAATTAGCTGGG - Intronic
1131320939 15:91390542-91390564 GAAAGTGAACTGAAATATTTAGG + Intergenic
1131539467 15:93264098-93264120 TAAAATGCAATGAAATATTTGGG - Intergenic
1131944251 15:97601643-97601665 TAAAATGCACAGAAATGATATGG - Intergenic
1132110958 15:99102070-99102092 GAAAATGCAGTGAAATACTGAGG + Intronic
1202951808 15_KI270727v1_random:45841-45863 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1135005728 16:18820361-18820383 GAAAATACAAAAAATTAGTTGGG - Intronic
1135242177 16:20817672-20817694 GAAAATGAAGTGAAATACTTAGG - Intronic
1135655734 16:24247249-24247271 GAAAACCCACAGAACAAGTTTGG + Intergenic
1135880424 16:26250216-26250238 GAAAATATACAGCAATGGTTTGG - Intergenic
1136130039 16:28214142-28214164 GAAAATACAAAAAATTAGTTGGG - Intergenic
1136170282 16:28485264-28485286 GAAAATACACAGAACTAATCAGG + Intronic
1136729732 16:32398829-32398851 GAAAATGCACAAAGATATTCAGG - Intergenic
1137337091 16:47560427-47560449 TAAAATGCACAGGAAAGGTTAGG + Intronic
1137609814 16:49810795-49810817 GTAAATGCACAGAAAGTGTCCGG - Intronic
1138568172 16:57849030-57849052 GGAAAAGCACAGAAAAAGTGTGG - Intronic
1138998070 16:62477351-62477373 AAAAATACAAAAAAATAGTTGGG - Intergenic
1139035575 16:62942059-62942081 GAAAATACAAAAAAATAGCTGGG - Intergenic
1139159556 16:64487962-64487984 AAAAATACAAAGAATTAGTTAGG + Intergenic
1139747706 16:69087861-69087883 AAAAATACAAAAAAATAGTTGGG - Intergenic
1140138513 16:72230562-72230584 AAATTTGGACAGAAATAGTTGGG - Intergenic
1140587239 16:76307996-76308018 GAAAATGCATAGAAATTTATAGG + Intronic
1141251403 16:82362296-82362318 GCAAATGAACAGAAATAGACGGG + Intergenic
1141888282 16:86908353-86908375 GGAAATGCACAGAAATGCTGAGG - Intergenic
1202996664 16_KI270728v1_random:118475-118497 GAAAATGCACAAAGATATTCAGG + Intergenic
1203011798 16_KI270728v1_random:299246-299268 GAATCTGCAAAGAAATATTTGGG + Intergenic
1203023351 16_KI270728v1_random:430817-430839 GAAAATGCACAAAGATATTCAGG + Intergenic
1203030133 16_KI270728v1_random:572405-572427 GAATCTGCAAAGAAATATTTGGG + Intergenic
1203041588 16_KI270728v1_random:762026-762048 GAATCTGCAAAGAAATATTTGGG - Intergenic
1143440708 17:6971382-6971404 GAAAATGTACAGTAAAAGTATGG + Intronic
1143687001 17:8525306-8525328 GAAGAAGCACAGAAACAGTGTGG - Intronic
1144395030 17:14835471-14835493 AAAAATACACAAAATTAGTTGGG + Intergenic
1144570210 17:16392810-16392832 AAAAATGCAAAGAATTAGCTGGG + Intergenic
1145200465 17:20940368-20940390 GAAAATTCTGAGAAATACTTAGG - Intergenic
1145362363 17:22222574-22222596 AAAAATGCAAAGAATTAGCTGGG + Intergenic
1145767283 17:27467502-27467524 GAACATTCAAAGAAATATTTGGG - Intronic
1145857531 17:28176013-28176035 GAAAATCCATAGAAAAATTTGGG + Intronic
1147204252 17:38825240-38825262 GAAAACGTAGAGAAATAGTTCGG + Exonic
1147444747 17:40468041-40468063 GAAAATACAAAAAAATAGCTGGG - Intergenic
1147569552 17:41560228-41560250 GAAAATGCAGAGCAATACTGTGG + Intergenic
1147679378 17:42230819-42230841 GAAAATACAAAAAATTAGTTGGG - Intronic
1148165270 17:45479356-45479378 AAAAATGCAAAAAAATAGCTGGG + Intronic
1148847759 17:50539161-50539183 CAGAAGGCACAGAAAGAGTTAGG - Intronic
1149355858 17:55838700-55838722 GATAATGCACATAAATTGCTTGG - Intronic
1149945277 17:60918851-60918873 AAAAATACACAAAATTAGTTGGG - Intronic
1150396498 17:64826079-64826101 AAAAATGCAAAAAAATAGCTGGG + Intergenic
1150421315 17:65038569-65038591 AAAAATACAGAAAAATAGTTGGG - Intronic
1150730381 17:67687931-67687953 GAAGATGCAAAGAAATGATTTGG - Intronic
1151075234 17:71264379-71264401 AAAAATGCAAAAAATTAGTTGGG + Intergenic
1151257452 17:72889929-72889951 GAAAATGCATAGAGTTAGGTGGG + Intronic
1151332012 17:73415504-73415526 AAAAATGAACAGAACTAGCTTGG - Intronic
1153245629 18:3070590-3070612 GAAAATGCACAGTACTTGTTGGG + Intronic
1153246201 18:3074727-3074749 GAAAATGTACAGTATTTGTTGGG + Intronic
1153404112 18:4716724-4716746 GAAAATTCATATAAATAGTAAGG + Intergenic
1153577261 18:6535149-6535171 AAAAATACACAGAAATTATTTGG - Intronic
1154205189 18:12330163-12330185 AAAAATGCAAAAAAATAGCTGGG + Intronic
1154296222 18:13151752-13151774 GAAGATGCACAGTTATACTTCGG - Intergenic
1155334849 18:24753075-24753097 GAAGATGAGCAGAAATAGGTAGG - Intergenic
1155583148 18:27335028-27335050 CAAAATGCACAGAAATTGCAAGG - Intergenic
1156908614 18:42384197-42384219 GAAAATACACTGAAGTATTTAGG - Intergenic
1157588884 18:48824078-48824100 GATAGTGCACAGAAATAGAAAGG - Intronic
1157894581 18:51453080-51453102 GGAAATGCACAAAAACATTTCGG + Intergenic
1158038428 18:53063724-53063746 GAAACTACTCAGAAATACTTAGG - Intronic
1158902189 18:61974313-61974335 GATAATGCACAGAGATACCTGGG + Intergenic
1159405385 18:67995503-67995525 GAAAAAGTACAGAAATAATGAGG + Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1159574546 18:70159039-70159061 GAAAACTAACAAAAATAGTTGGG + Intronic
1163315278 19:16536849-16536871 GAAAATGCAAAAAATTAGTCGGG + Intronic
1163772802 19:19200957-19200979 AAAAATGCAAAAAATTAGTTGGG - Intronic
1164031190 19:21407186-21407208 GAAAATACAAATAATTAGTTGGG + Intronic
1164337139 19:24337266-24337288 GAAACTGCAAAGAGATATTTTGG + Intergenic
1164361986 19:27523097-27523119 GAAACTGCAAAGACATATTTGGG + Intergenic
1164365341 19:27574994-27575016 GAATCTGCACAGAGATATTTGGG + Intergenic
1164368499 19:27616781-27616803 GAAACTGCAAAGGAATATTTGGG + Intergenic
1165173523 19:33909990-33910012 GAAAATACAAAGAATTAGCTGGG + Intergenic
1167859743 19:52273167-52273189 AAAAATGCAAACAATTAGTTGGG - Intronic
925586650 2:5471268-5471290 AAAAATGCAAAAAAATAGCTGGG + Intergenic
926162511 2:10498893-10498915 GGAAGTGCTCAGAAATATTTGGG - Intergenic
926294824 2:11561522-11561544 GAAAATACAAAAAATTAGTTGGG - Intronic
927283394 2:21331515-21331537 GAAAATACACAGATAAAGTCTGG - Intergenic
927686211 2:25173127-25173149 AGAAATGCACAAAAATAGTGAGG - Intergenic
929021640 2:37559238-37559260 GAAAATGGAATGACATAGTTAGG - Intergenic
929153021 2:38764901-38764923 GAAAATCCACATAAAGAGTATGG + Intronic
930227581 2:48809984-48810006 AAAAATGTACAGAAATAGATGGG - Intergenic
930394913 2:50809655-50809677 GATTATCCACAGAAGTAGTTGGG - Intronic
930413567 2:51059120-51059142 GAGAAAGCAGAGAAATTGTTTGG + Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932365863 2:71153102-71153124 AAAAATGCAAAAAAATAGCTGGG - Intergenic
932729945 2:74212425-74212447 AAAAATACACAAAATTAGTTGGG - Intronic
933160177 2:79015214-79015236 TAAAATGCACTAAAATAGTGGGG + Intergenic
933660396 2:84922929-84922951 GAAAATACAAAGAATTAGCTGGG + Intergenic
933877723 2:86635514-86635536 GAAAATGCCCAGAACTATTGAGG - Intronic
934477052 2:94600716-94600738 AAAAATACAAAAAAATAGTTGGG + Intronic
935009165 2:99115091-99115113 TAAAATGCAAAAAAATAGCTGGG - Intronic
935279593 2:101505985-101506007 AAAAAGGCACAGAGATGGTTGGG + Intergenic
937839521 2:126511512-126511534 GACAAGGCAGAGAAATAATTTGG - Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
938811706 2:134860000-134860022 GAAAAGGCACAGTAACAGTTTGG + Intronic
939041836 2:137198707-137198729 GAGAATCCACAGAAATGGTAAGG - Intronic
939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG + Intronic
940050303 2:149455417-149455439 AAAAATACACAAAATTAGTTGGG - Intronic
940556969 2:155241080-155241102 AAAAATGCACAGAAGTATTTAGG + Intergenic
940720016 2:157271768-157271790 GAAGATGTTCAGAAATTGTTTGG + Intronic
941264439 2:163342552-163342574 GAAAAAGCAGAGAAAAAATTTGG - Intergenic
941438602 2:165505256-165505278 GAAAATAGACAGAAATAAATGGG - Intronic
941677515 2:168359685-168359707 TAAAATGCAGTCAAATAGTTAGG + Intergenic
942363966 2:175202941-175202963 AAATATGCACAGAAATATTAAGG - Intergenic
942427088 2:175871499-175871521 GAAATTGAAAAGAAATATTTTGG - Intergenic
942439854 2:176021114-176021136 GAAAATACAAAAAAATAGCTGGG + Intergenic
942629167 2:177937476-177937498 GAAAATACAAAAAATTAGTTGGG - Intronic
943151046 2:184113493-184113515 GAAAATGAATAGACATTGTTTGG - Intergenic
943281529 2:185940650-185940672 GAAAATGCAAAAAATTAGTCAGG - Intergenic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944068050 2:195639885-195639907 GAAAATCCACATAAATTATTTGG + Intronic
944418036 2:199498263-199498285 AAAAATAAAAAGAAATAGTTGGG - Intergenic
944637021 2:201684347-201684369 CAAAGTGCAGAGAAAAAGTTGGG + Intronic
944832882 2:203550294-203550316 GAAAAAGCTCAGAAATATTAAGG + Intergenic
944914608 2:204345484-204345506 GAATATGTACAGAAATTATTTGG - Intergenic
945168617 2:206972460-206972482 GAAAAAGCACTGATAGAGTTTGG - Intergenic
945232618 2:207608401-207608423 AAAAATCATCAGAAATAGTTGGG - Intronic
945443040 2:209903161-209903183 TAAAATGCACAGACATTTTTGGG - Intronic
945685732 2:212967172-212967194 GAAACTGCACAGAAAGAAATGGG + Intergenic
945791813 2:214314781-214314803 GAACATCCAGAGAAATAGTTGGG + Intronic
945812969 2:214570522-214570544 AAAAATGCAAAGAATTAGCTGGG - Intronic
945819354 2:214644856-214644878 GAAAATGCACAAAAAAATGTTGG - Intergenic
945998975 2:216464984-216465006 AAAAATGAACAGAATTAGCTGGG + Intronic
946934727 2:224708242-224708264 GAATATTTACAGAAATATTTTGG + Intergenic
947952106 2:234157094-234157116 AAAGATGCACAGAAACTGTTTGG - Intergenic
1169155666 20:3327619-3327641 GAAAAAACACAGAAATGATTTGG + Intronic
1169564344 20:6837230-6837252 CAAAATTCACAGAAAAAGGTAGG + Intergenic
1170361368 20:15549815-15549837 GAAAATGCACAGACAATATTTGG - Intronic
1170424538 20:16225837-16225859 GAAAAAGCACAGAATTTGTATGG - Intergenic
1170775252 20:19369647-19369669 GAAAATACACTAAAATACTTAGG + Intronic
1170807763 20:19648026-19648048 GAAAATGGACAGTAATAATTGGG - Intronic
1171061806 20:21971635-21971657 GAAACAGCCCAGAAATAGTTTGG - Intergenic
1171070319 20:22062101-22062123 GACAAAGCTCAGACATAGTTTGG - Intergenic
1171157205 20:22886936-22886958 GAAAATCAACAGAGATAGTCAGG - Intergenic
1173262781 20:41451478-41451500 GAAAAGGCACAGACAGAGGTGGG + Intronic
1173739172 20:45384593-45384615 GCAAATGCACAGAAAAAGGAAGG - Intronic
1173988310 20:47279961-47279983 GAAAATACAAAAAATTAGTTGGG + Intronic
1175850101 20:62085785-62085807 GAAAATACAAAGAATTAGCTGGG - Intergenic
1177006387 21:15677388-15677410 GTAAATGCAGAGAAAATGTTTGG - Intergenic
1177216671 21:18138968-18138990 GAAAAAGCTAACAAATAGTTTGG + Intronic
1177488221 21:21786718-21786740 AAAAATACAAAAAAATAGTTTGG - Intergenic
1177565460 21:22815819-22815841 GAAAATGCACAAAAATATTCTGG - Intergenic
1177679491 21:24347399-24347421 GAAAATACACAAAATTAGCTGGG - Intergenic
1179309174 21:40181734-40181756 GACAATGCACAGAAATCGTTTGG + Intronic
1181877065 22:25947941-25947963 ATAAGTGCACAGAGATAGTTAGG + Intronic
1182724177 22:32429365-32429387 GAAAATGCAAAAAATTAGCTGGG - Intronic
1182775797 22:32830132-32830154 GAAAATGCAAAGTACTAGCTGGG - Intronic
1183005839 22:34901227-34901249 GAAAATGAAGAGAAATCCTTGGG + Intergenic
1183578963 22:38711680-38711702 AAAAATGCAAAAAATTAGTTGGG + Intronic
1184051858 22:42012829-42012851 AAAAATGCAAAAAATTAGTTGGG + Intronic
1184508303 22:44917329-44917351 GAAAATGCACAGGAAGTGCTGGG + Intronic
949390175 3:3553211-3553233 GAAAATGCTGAGAAATATCTAGG + Intergenic
951230492 3:20172995-20173017 AAAAATGTCCAGAAAAAGTTGGG - Intronic
951436221 3:22668061-22668083 GCAAATGGACAGAAATATATTGG + Intergenic
952018040 3:28982788-28982810 AAAAATGCATATAAATATTTTGG + Intergenic
954040792 3:47885887-47885909 AAAAATGCAAAGAATTAGTTGGG - Intronic
954902066 3:54028261-54028283 GAAAATATACTGCAATAGTTAGG - Intergenic
955360682 3:58271923-58271945 GAAAATGCAAAAAATTAGCTGGG - Intronic
955976225 3:64482852-64482874 GAAAAAACACAAAAATAGTCTGG + Intergenic
956632918 3:71333662-71333684 AAAAATACAAAGAAATAGCTGGG + Intronic
957741234 3:84271816-84271838 GAAAAAGCAGAGGAACAGTTAGG + Intergenic
958013432 3:87910570-87910592 GAAAATTAACAGAGATATTTAGG + Intergenic
958679712 3:97312466-97312488 GAAAATGCACTGGAACATTTTGG + Intronic
958769065 3:98404611-98404633 GAAAATTAACAAAAATATTTAGG + Intergenic
959441405 3:106379821-106379843 CAAAATGCATTGAAATTGTTTGG - Intergenic
960164704 3:114388366-114388388 GGAAAAGTACAGAAATAATTTGG - Intronic
961023909 3:123535202-123535224 GAAAACGCACAGTAAAAGTATGG - Intronic
962113372 3:132474067-132474089 GAAAATGCTCAGTCATAGCTTGG + Intronic
962593320 3:136913827-136913849 AAAAATACACAAAATTAGTTGGG - Intronic
962832090 3:139152170-139152192 GAAAATTCACAAAAATATTCAGG + Intronic
963444709 3:145389370-145389392 GAAAAGGCAGAGAAAGAGATAGG + Intergenic
963523986 3:146393187-146393209 GAAAATACAAAAAATTAGTTGGG - Intronic
963665711 3:148183432-148183454 CAATATGCACAGTAATAATTCGG + Intergenic
963834973 3:150048931-150048953 GAAAATGAAAAGAAATTGTGTGG + Intronic
964120739 3:153180517-153180539 AAAAATGCAAAAAATTAGTTGGG - Intergenic
964627992 3:158777407-158777429 GAAAATACACAGGACAAGTTTGG - Intronic
965703317 3:171480749-171480771 AAAAAAGCTCAGAAATAGTCTGG + Intergenic
966145096 3:176802233-176802255 GAAAATTAACAAAGATAGTTAGG + Intergenic
967317983 3:188167754-188167776 GAAAAGTCATAGAAATAGTTGGG - Intronic
967351359 3:188517406-188517428 GAAACTAGATAGAAATAGTTTGG + Intronic
967507852 3:190273498-190273520 GAAAATGCCCTGAAATACTGGGG - Intergenic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970567048 4:17341688-17341710 GAAAATTCACAGAAAGCTTTTGG - Intergenic
971142256 4:23936986-23937008 GAAAATGCTCAGAAATAAGAAGG + Intergenic
973349186 4:49091010-49091032 GAATATGCACAGAAACATTTGGG + Intergenic
973643851 4:52930573-52930595 GAAAATTTTTAGAAATAGTTGGG - Intronic
973725265 4:53769407-53769429 GAAAAGGCACAGTAAAAATTTGG - Intronic
974547440 4:63331094-63331116 GAATCTGCACAGAGATATTTGGG - Intergenic
974548307 4:63340716-63340738 GAATCTGCACACAAATATTTGGG - Intergenic
974548416 4:63342240-63342262 GAATCTGCACAGGAATATTTGGG - Intergenic
975412954 4:74076157-74076179 AAAAATACACAAAATTAGTTGGG - Intergenic
975450288 4:74517851-74517873 AAAAATACAAAGAATTAGTTGGG - Intergenic
976479256 4:85520573-85520595 TAGAATGCAGAGAGATAGTTAGG - Intronic
976602826 4:86954005-86954027 GAAAATGCACTGAACTAGGCCGG - Intronic
977249276 4:94671215-94671237 GTGAGTGCACAGAAAGAGTTGGG + Intergenic
977449449 4:97176417-97176439 AAAAATACAAAAAAATAGTTGGG - Intergenic
977530581 4:98195858-98195880 AAAAATACAAAAAAATAGTTAGG + Intergenic
977729586 4:100334670-100334692 GAAAATGAACAAAGATATTTAGG + Intergenic
978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG + Intergenic
978723517 4:111943711-111943733 GAAAGTGCACCCAAAAAGTTTGG + Intergenic
979237131 4:118413795-118413817 AAAAATGCACACAAAACGTTAGG - Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
979412735 4:120398580-120398602 AAAAATCCACAGAAATTTTTTGG + Intergenic
979679078 4:123439721-123439743 GAAAATACAAAAAATTAGTTGGG + Intergenic
980021501 4:127715301-127715323 GAAAGGGCACAGAATTAGTTGGG + Intronic
980610737 4:135159058-135159080 GCAAATACAGAGAACTAGTTTGG - Intergenic
981213331 4:142134634-142134656 AAAAATGCAAAAAATTAGTTGGG + Intronic
981304339 4:143230316-143230338 GAAAATACACAAAATTAGCTGGG - Intergenic
981695401 4:147554087-147554109 AAAAAGGCACTGATATAGTTTGG - Intergenic
981769023 4:148285232-148285254 GAAAATGCTAAAAAATATTTAGG + Intronic
981978256 4:150758732-150758754 GAAAATAAAAAGAATTAGTTGGG - Intronic
982215272 4:153077404-153077426 AAACATACACAGAAATATTTAGG - Intergenic
982767344 4:159364265-159364287 GAAGATGCAGAGAAATTGGTTGG + Intergenic
982974183 4:162032458-162032480 GAAAATGCACAGAAATAGTTTGG + Intronic
983333198 4:166358261-166358283 GAAAATCAACATAAATATTTGGG + Intergenic
983727993 4:170953940-170953962 AAAAATGCAAAAAAATAGCTGGG + Intergenic
983874311 4:172858520-172858542 GAAAATCCAAAGAAAAACTTTGG + Intronic
984470595 4:180167456-180167478 AAAGATGCACTGAAATAGATGGG + Intergenic
984858591 4:184217191-184217213 GAAAAGGGACAGAAGGAGTTTGG + Intronic
985264589 4:188146084-188146106 GATAATGTACAGAAAATGTTTGG + Intronic
986045754 5:4036078-4036100 GAAAATGCACAGAACGGGTGAGG + Intergenic
986275700 5:6273474-6273496 GAAACTGCGCAGAAAAAGCTAGG + Intergenic
986591733 5:9377644-9377666 AAAAAGGCAAAGAAATAATTAGG + Intronic
986889729 5:12287746-12287768 TCAAATATACAGAAATAGTTGGG + Intergenic
987220248 5:15783734-15783756 GAGCATTCAGAGAAATAGTTAGG + Intronic
987285143 5:16448718-16448740 GAAAATACACAAAATTAGCTGGG - Intergenic
988071985 5:26302924-26302946 GCAATTGTACAAAAATAGTTGGG - Intergenic
988152409 5:27401890-27401912 GAAAATACACTGAAAATGTTGGG + Intergenic
988173879 5:27695098-27695120 GAAAATGAAGATAAATAGCTGGG + Intergenic
988677697 5:33450322-33450344 GAACAAGCACAAAAACAGTTTGG + Intronic
988844959 5:35118472-35118494 GAAAACACACTGAAATATTTAGG - Intronic
989340955 5:40375159-40375181 AAAAATGCACATAAATAGCACGG + Intergenic
989631842 5:43492625-43492647 AAAAATGAACTGAAATAGTGTGG + Intronic
989830516 5:45912111-45912133 GAATCTGCACAGAGATATTTGGG - Intergenic
989835809 5:45988990-45989012 GAATATGCAAAGGAATATTTGGG + Intergenic
989838307 5:46024876-46024898 GAAAATGCAAAGGGATATTTGGG + Intergenic
990121214 5:52454717-52454739 GACAATGAACAGAATTAGTTTGG - Intergenic
990441120 5:55846395-55846417 TAAAATGTACAGAAATATTATGG - Intergenic
991083956 5:62631229-62631251 AAAAATGCAAAGAATTAGCTGGG - Intergenic
991242588 5:64476601-64476623 GAAAATGAACAAAAATATTCAGG + Intergenic
991476964 5:67032113-67032135 GATAATTCACAGAAAGATTTAGG - Intronic
991572673 5:68072260-68072282 TAAAATGCAAAGTAATAGCTTGG - Intergenic
993333071 5:86623612-86623634 AAAAATACAAAAAAATAGTTGGG + Intergenic
993372646 5:87111542-87111564 AAAAATACAAAAAAATAGTTGGG + Intergenic
993519969 5:88889010-88889032 GAAAAAGCACACACATAGTAAGG - Intronic
994068502 5:95570940-95570962 GAAAATACAAAAAATTAGTTGGG - Intronic
994279125 5:97878901-97878923 GAAGATTTCCAGAAATAGTTTGG + Intergenic
994656589 5:102601674-102601696 GAAAAAGCACGGAAATAACTAGG + Intergenic
994754503 5:103778181-103778203 GAAAATGCAAAAAATTAGCTGGG + Intergenic
995372602 5:111436031-111436053 AAAAATGAACAGAAAAAGCTAGG - Intronic
996515895 5:124368976-124368998 GAAAATGGACTAAAACAGTTGGG - Intergenic
996945820 5:129066351-129066373 GTAAATGCACACAATTTGTTAGG - Intergenic
997946541 5:138207794-138207816 AAAAATACAAAAAAATAGTTGGG + Intronic
998183784 5:139963592-139963614 GAAAATGCATATAAAGTGTTTGG - Intronic
999611560 5:153375564-153375586 GAAAATGCACAGAATTGCTGGGG - Intergenic
1000156554 5:158558067-158558089 GAAAATGGAGATAAATAGTCTGG + Intergenic
1000208574 5:159087862-159087884 GGATTTGCTCAGAAATAGTTAGG + Intronic
1001058587 5:168469502-168469524 AAAAATGCACAGAAACCATTGGG + Intronic
1001368000 5:171163733-171163755 GAAAATTCACAGTAATATTTGGG + Intronic
1001713408 5:173795524-173795546 AAAAAGACACAGAAATTGTTAGG + Intergenic
1002791766 6:442184-442206 GACAATGCACTTAAATATTTGGG + Intergenic
1004629052 6:17404442-17404464 GAAAATACAAAAAAATAGCTGGG + Intronic
1005300723 6:24467860-24467882 GAAACCACACAGAAATAGATTGG - Intronic
1005368334 6:25102681-25102703 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1005510164 6:26505583-26505605 AAAAATACACAAAATTAGTTGGG - Intronic
1010128370 6:72462046-72462068 GAAAGTGAAGAGAAATTGTTAGG + Intergenic
1010143379 6:72637735-72637757 GAAAAGGCAGAGAAATTGATTGG + Intronic
1010336577 6:74691434-74691456 GAAAATTAAAAGGAATAGTTGGG - Intergenic
1010725510 6:79328213-79328235 GAAATTGCAGAGAAATAGGCAGG - Intergenic
1010775162 6:79877066-79877088 GAAAAAGCACAGAAAACATTGGG - Intergenic
1012153975 6:95793372-95793394 GAAAATGTTAAGAAATGGTTGGG + Intergenic
1012234445 6:96797050-96797072 GAAAATACAAAAAAATAGCTGGG + Exonic
1012261931 6:97097476-97097498 GATATTGCACGGATATAGTTTGG + Intronic
1012433555 6:99191077-99191099 GAATATTCAAATAAATAGTTTGG - Intergenic
1012495710 6:99831404-99831426 GAAAAAGAGCAGGAATAGTTAGG - Intergenic
1013732347 6:113183769-113183791 GAAAATGGACAGAACTGCTTTGG - Intergenic
1013941950 6:115675061-115675083 GAAAATACAAAGAATTAGCTGGG - Intergenic
1014080891 6:117284642-117284664 TAAAATGCATAGAAATAGAATGG + Intergenic
1014265377 6:119270905-119270927 CAATATTCACAGAAACAGTTGGG - Intronic
1014492304 6:122077439-122077461 AAAAATGCAAAAAATTAGTTGGG + Intergenic
1014632629 6:123804447-123804469 TAAAAGGGACAGAAATAGGTGGG - Intronic
1015037580 6:128675746-128675768 GAATATGTAAAGGAATAGTTGGG + Intergenic
1015311470 6:131771525-131771547 CAAAAAGCACAAAATTAGTTTGG + Intergenic
1015653466 6:135490370-135490392 GAAAATGACCAGAGATAGTGGGG - Intronic
1016301894 6:142641638-142641660 AAAGATGCACAGGAATGGTTAGG - Intergenic
1016871446 6:148821128-148821150 GAAAATACACAAAATTAGCTGGG - Intronic
1017175613 6:151501674-151501696 AAATATGCAAAGAAAAAGTTTGG - Intronic
1018231775 6:161682440-161682462 AAACATGTACAGAAATGGTTAGG + Intronic
1019191072 6:170251302-170251324 GAAAATCTCCAGAAATACTTGGG - Intergenic
1019671993 7:2285226-2285248 AAAAATGCAAAAAATTAGTTAGG + Intronic
1020197104 7:6049380-6049402 GAAAATACAAAAAATTAGTTGGG + Intronic
1021032430 7:15754315-15754337 AAAAATGAAGAGAAATATTTTGG + Intergenic
1021125403 7:16846387-16846409 GAAAGTCCAGAGAAATAATTGGG - Intergenic
1021728023 7:23568692-23568714 GAAAATACAAAAAAATAGCTGGG - Intergenic
1024399307 7:48905557-48905579 AAAAATGCAAAAAAATAGCTGGG - Intergenic
1024619433 7:51145173-51145195 GAAAATACAAAAAATTAGTTGGG - Intronic
1024789175 7:52943316-52943338 AAAAATACACAAAATTAGTTGGG + Intergenic
1024879936 7:54073510-54073532 GCATATGCACAGAATTACTTTGG + Intergenic
1025526020 7:61811848-61811870 GAATATGCAAAGAGATATTTGGG - Intergenic
1025548444 7:62208590-62208612 GAACCTGCAAAGGAATAGTTGGG - Intergenic
1025582939 7:62742620-62742642 GGAAAAGCACAGAATTAGTGTGG + Intergenic
1025593783 7:62898699-62898721 GAATATGCAAAGACATATTTGGG - Intergenic
1026384921 7:69837209-69837231 ACAAATGCACATAGATAGTTAGG + Intronic
1026542397 7:71291031-71291053 GATAATGCATGGAAATACTTTGG + Intronic
1028295272 7:89121822-89121844 CAAAATGCACAGAAAAAATCGGG + Intronic
1028348825 7:89818306-89818328 GAAAGTGCACAGAAAATGATTGG - Intergenic
1028394639 7:90354275-90354297 TAAAATGCAAAGAAATAATTAGG + Intronic
1028406735 7:90483483-90483505 GCCAATGCACAGAAATAGGCTGG - Intronic
1029619831 7:101683296-101683318 GAGGATGCACAGAAATTGCTGGG - Intergenic
1030307666 7:108035379-108035401 AAAAATGCAAAAAATTAGTTGGG + Intronic
1030377274 7:108768108-108768130 GAAATTGCACATAAACATTTTGG + Intergenic
1030569855 7:111209789-111209811 GAAACTGCCCAGAAAGAGGTGGG + Intronic
1030817322 7:114053813-114053835 AAACATGTACAGAAATATTTAGG - Intronic
1030854178 7:114530808-114530830 AAAATTGCACAGTAAGAGTTAGG + Intronic
1031486411 7:122331476-122331498 GAAAATACAAAAAATTAGTTGGG + Intronic
1031532437 7:122891556-122891578 GAAAATGAACAGAAATGAGTTGG + Intergenic
1031960687 7:127986867-127986889 GAAAATGCTCAGGAATTTTTGGG + Intronic
1032444784 7:131972902-131972924 GAAAATGGTAAGAAATATTTAGG + Intergenic
1032915675 7:136486712-136486734 GAGACTGCACAGAATAAGTTAGG + Intergenic
1033112377 7:138591932-138591954 AAAAATGGTCACAAATAGTTTGG + Intergenic
1033779876 7:144656113-144656135 AAAAATGCACAAATATATTTAGG - Intronic
1033838809 7:145348454-145348476 AAAAATGAAAAGAAATAGCTAGG + Intergenic
1034055211 7:148027072-148027094 GAAAACCCACAGAAAAAATTAGG - Intronic
1034309034 7:150070953-150070975 AAAAATGCAAAAAATTAGTTGGG - Intergenic
1034320532 7:150176131-150176153 TAAAAGGCTCAGAAATACTTTGG - Intergenic
1034644459 7:152633026-152633048 GAAAAAGCAAAGAAATAGGCCGG + Intergenic
1034772211 7:153791098-153791120 TAAAAGGCTCAGAAATATTTTGG + Intergenic
1034797818 7:154029683-154029705 AAAAATGCAAAAAATTAGTTGGG + Intronic
1036386597 8:8287179-8287201 GGAAATTCCCAGAAATATTTTGG - Intergenic
1036947662 8:13109722-13109744 GAAAATACACAAAATTAGCTGGG + Intronic
1037137609 8:15481514-15481536 GAAAATGAACAGAAATTTATTGG - Intronic
1037221310 8:16525903-16525925 TAAAATGCACAGAAATGCATGGG - Intronic
1037426890 8:18765805-18765827 AAAAATACAAAGAATTAGTTTGG + Intronic
1038199915 8:25402455-25402477 AAAAATGCAAAAAAATAGCTGGG - Intronic
1039083466 8:33756897-33756919 TCAAATGCACAGTAATAGCTAGG + Intergenic
1040116804 8:43631001-43631023 GAATCTGCAAAGAAATATTTGGG + Intergenic
1040121036 8:43686311-43686333 GTAAATGCAAAGGAATATTTAGG + Intergenic
1040137821 8:43875907-43875929 GAACCTGCAAAGAAATATTTGGG - Intergenic
1040138168 8:43879702-43879724 GAATCTGCAAAGAAATATTTGGG - Intergenic
1040292228 8:46131388-46131410 GAAATAGCCCAGAAAGAGTTTGG + Intergenic
1040327262 8:46356141-46356163 GAAAATGCAAATAAATATTTTGG - Intergenic
1040795821 8:51289237-51289259 AAAAATGCAAAAAATTAGTTGGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041532591 8:58887630-58887652 GAAAATACAATGAAATAGGTTGG - Intronic
1042259914 8:66847994-66848016 GTAAATGCACAAAAATATTGAGG + Intronic
1042675884 8:71321420-71321442 AAATATGCACAAAAATATTTTGG + Intronic
1043278251 8:78429210-78429232 AAAAATGCTCAAAAATAGTCTGG + Intergenic
1043719121 8:83523501-83523523 TAAAATGCATAGAAAAACTTGGG + Intergenic
1043741659 8:83821233-83821255 GAAAAGATAGAGAAATAGTTGGG - Intergenic
1043867233 8:85389304-85389326 AAAAATGCAAAGAATTAGCTGGG + Intronic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1044288945 8:90445107-90445129 GAAATTGCAGAGAACTATTTTGG - Intergenic
1044323549 8:90833788-90833810 AAAAATGTACAGAATTGGTTGGG - Intronic
1044361573 8:91291446-91291468 AAAAATGAAAAGAAATCGTTAGG - Intronic
1045069653 8:98488740-98488762 GAAAATGCAGAGAAGTGGTATGG + Intronic
1045656286 8:104390656-104390678 AAAAATGCAAAAAATTAGTTGGG - Intronic
1045689676 8:104747347-104747369 GAAAATGCAAAAAGTTAGTTGGG + Intronic
1046110721 8:109720710-109720732 TCAGATGCATAGAAATAGTTTGG + Intergenic
1046138019 8:110056232-110056254 GAAAAGGCAGAAAAATATTTTGG - Intergenic
1046413255 8:113876436-113876458 GAAAATACAGAAAATTAGTTGGG - Intergenic
1047624062 8:126637471-126637493 GAAAATGCAAAAAATTAGCTGGG - Intergenic
1047759458 8:127943439-127943461 GAAATTGCAAAGACATAGGTAGG + Intergenic
1047814476 8:128447865-128447887 GAGAATGCAAAGAAAGAATTGGG + Intergenic
1047950689 8:129932157-129932179 GAAAATGCAAAAAATTAGCTGGG - Intronic
1050369467 9:4905802-4905824 GAAAATGGAGAGAAATATGTTGG + Intergenic
1050799258 9:9588600-9588622 AAAGTTGCACAGAAATAATTAGG + Intronic
1050905441 9:10997732-10997754 GAGAATGCAAAGAACAAGTTAGG + Intergenic
1051241349 9:15059827-15059849 GAATATGCACTGAAGTATTTAGG + Intergenic
1051319010 9:15879581-15879603 AACAATGCACACAAATAGTATGG - Intronic
1051502667 9:17795204-17795226 GATAATGCCCAGAAATAGGAGGG - Intronic
1052852975 9:33389186-33389208 AAAAATACAAAAAAATAGTTGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053681018 9:40485376-40485398 AAAAATACAAAAAAATAGTTGGG - Intergenic
1053931006 9:43113690-43113712 AAAAATACAAAAAAATAGTTGGG - Intergenic
1054282695 9:63139558-63139580 AAAAATACAAAAAAATAGTTGGG + Intergenic
1054294103 9:63320891-63320913 AAAAATACAAAAAAATAGTTGGG - Intergenic
1054392125 9:64625380-64625402 AAAAATACAAAAAAATAGTTGGG - Intergenic
1054426772 9:65130591-65130613 AAAAATACAAAAAAATAGTTGGG - Intergenic
1054503603 9:65890949-65890971 AAAAATACAAAAAAATAGTTGGG + Intronic
1054717671 9:68572714-68572736 GAAAATTCACACCAATAGTAAGG + Intergenic
1055370747 9:75596092-75596114 GTAAATGCAGATATATAGTTAGG + Intergenic
1055600931 9:77917722-77917744 GAAAATGCAAAATAATATTTAGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057937197 9:99250159-99250181 GTAAAAACACAGAAATAATTGGG - Intergenic
1058428062 9:104893259-104893281 GAAAATACAAAAAAATAGCTGGG + Intronic
1058484162 9:105426464-105426486 GTAGATGCAAAGAAATAGTGGGG - Intronic
1058755275 9:108077723-108077745 AAAAACCCACAGGAATAGTTTGG - Intergenic
1059170521 9:112120314-112120336 CAAAATACACAGAGACAGTTGGG + Intronic
1059483213 9:114608226-114608248 GAAAATGCTCAGTAAAAGTGTGG - Intergenic
1059701542 9:116779684-116779706 GAAAATGAACAGAAAAAGAAGGG - Intronic
1060049505 9:120367546-120367568 AAAAATACAAAAAAATAGTTGGG + Intergenic
1061964626 9:134005950-134005972 AAAAATGCAAAAAAATAGTCAGG + Intergenic
1202798049 9_KI270719v1_random:145355-145377 AAAAATGCAAAAAATTAGTTGGG + Intergenic
1203491034 Un_GL000224v1:104648-104670 CATAATTCACAGAAAGAGTTGGG - Intergenic
1203503658 Un_KI270741v1:46519-46541 CATAATTCACAGAAAGAGTTGGG - Intergenic
1185684832 X:1919648-1919670 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1186048641 X:5564742-5564764 AAAAATGCAAAGAATTAGCTGGG + Intergenic
1186461191 X:9749923-9749945 AAAAATACAAAGAAATAGCTGGG - Intronic
1186729440 X:12392720-12392742 GAAAATTCACAGACATAGGAAGG - Intronic
1186771034 X:12818414-12818436 GAAAATCCTCAGAAATAGGGAGG + Intronic
1187015283 X:15321168-15321190 AAAAATGCCCAGAAAACGTTTGG + Exonic
1188169720 X:26910065-26910087 GAAAAAGCACAGATATAGAGAGG + Intergenic
1188179026 X:27030714-27030736 AAATGTGCACAGGAATAGTTTGG + Intergenic
1188754088 X:33938954-33938976 GTAAATCCACTGATATAGTTTGG + Intergenic
1188809722 X:34638335-34638357 GAAAATGAACACAAACAGTAGGG + Intronic
1189026033 X:37395452-37395474 AAAAATGCAAAAAAATAGCTGGG + Intronic
1189866299 X:45331567-45331589 GAAAATGAATAGAATTAATTTGG - Intergenic
1190329601 X:49227483-49227505 AAAAATGAACAAAAATAGCTGGG - Intronic
1191119971 X:56893232-56893254 GAAAATTGACAGGAATATTTAGG + Intergenic
1191189539 X:57651604-57651626 GAAAATAAACAGTGATAGTTGGG - Intergenic
1191261207 X:58323871-58323893 GAATCTGCAGAGAAATATTTTGG + Intergenic
1191263220 X:58352279-58352301 GAATATGCAAAGGAATATTTGGG + Intergenic
1192374290 X:70543407-70543429 CAAAATGCACAGAGAAATTTTGG + Intronic
1192490552 X:71572804-71572826 AAAAATGCACAGAAATGTTCTGG + Intronic
1192979232 X:76320693-76320715 GAAAATTCACAAAGATATTTAGG - Intergenic
1193209596 X:78790468-78790490 GAAAATTAACAAAAATATTTAGG + Intergenic
1193457728 X:81751696-81751718 GAAAATGAACAAAAAAATTTTGG - Intergenic
1193817696 X:86123930-86123952 GAAAATTGACAGAGATATTTAGG - Intergenic
1194041046 X:88942386-88942408 GTAAATGGACAGAAATTGCTGGG - Intergenic
1194048741 X:89040660-89040682 GAAAATTCACAAAGATATTTAGG - Intergenic
1194213662 X:91100509-91100531 ATCAATGCCCAGAAATAGTTTGG + Intergenic
1194288837 X:92043000-92043022 GAAAATGCACAGCTATTTTTAGG - Intronic
1194313749 X:92347802-92347824 TAGATTCCACAGAAATAGTTGGG + Intronic
1194421228 X:93674883-93674905 GAAAATCCACAGAGGTAATTTGG + Intronic
1194679303 X:96832418-96832440 GAAAAGGGGCAGAAATAGATAGG + Intronic
1194764700 X:97836407-97836429 GAACATGGAGAGAAATATTTAGG - Intergenic
1195503591 X:105631435-105631457 GAAAATGGAGAGAAATGGTGAGG + Intronic
1195834717 X:109101529-109101551 GAAGAGGCACAGAAAGAGATAGG - Intergenic
1196222301 X:113125879-113125901 GAATGTGCACAGAAAAAGTCTGG - Intergenic
1196268282 X:113679131-113679153 GAAGATCCAAAGAAGTAGTTAGG + Intergenic
1196563095 X:117173886-117173908 GAACATAAACAGTAATAGTTGGG - Intergenic
1197007355 X:121517599-121517621 GAAAAATGACAGAAATAGCTGGG - Intergenic
1198569067 X:137935794-137935816 GAAAAAACACAAAAATACTTAGG + Intergenic
1198696620 X:139346746-139346768 CAAAATACAAAGAAATAGTTGGG - Intergenic
1198937457 X:141913470-141913492 GTTAATGCACAGAAATAAATTGG - Intergenic
1198961595 X:142189395-142189417 GTTAATGCACAGAAATAAATTGG + Intergenic
1199210622 X:145205916-145205938 GAAAGAGCACAGAAATTGTGAGG + Intergenic
1199394509 X:147319090-147319112 GAAAATGGACAGAGAAAATTTGG - Intergenic
1199748986 X:150796534-150796556 GCAAATGCACATTTATAGTTGGG + Intronic
1199840667 X:151644389-151644411 GAAACTGCACTGAGAGAGTTGGG - Intronic
1200606357 Y:5267567-5267589 GAAAATGCACAGCTATTTTTAGG - Intronic