ID: 982976053

View in Genome Browser
Species Human (GRCh38)
Location 4:162062570-162062592
Sequence TTCTATATGGATATAAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982976053_982976055 4 Left 982976053 4:162062570-162062592 CCTTACTTTATATCCATATAGAA 0: 1
1: 0
2: 3
3: 19
4: 277
Right 982976055 4:162062597-162062619 TTCTAAATAAGAATCCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982976053 Original CRISPR TTCTATATGGATATAAAGTA AGG (reversed) Intronic
903156965 1:21452217-21452239 TTTTATATGTATATAAAGGGAGG - Intronic
905163252 1:36056225-36056247 ATATATATGCATATGAAGTATGG - Exonic
905774376 1:40659153-40659175 TTCTCCATGGAGACAAAGTAGGG + Intronic
905968818 1:42124391-42124413 TTGTATATGGTTATGAGGTAGGG - Intergenic
907861124 1:58354487-58354509 TTCTATTTGGATAATATGTAAGG - Intronic
908371791 1:63488947-63488969 TTCCATATTGAAATTAAGTATGG - Intronic
909228292 1:73053936-73053958 TTCTATAGAGATATAAAGAGGGG + Intergenic
909416243 1:75408953-75408975 TGCTATATGAAAATAAAATAGGG + Intronic
909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG + Intronic
910389517 1:86724299-86724321 TTCTATATTTATAGAAAGAAAGG + Exonic
910886422 1:91968104-91968126 TACCATAAGGATATACAGTATGG - Intronic
912392363 1:109312657-109312679 TGCTATATAGAAATATAGTATGG - Exonic
914512539 1:148346509-148346531 TTCTATAAAGATAGAAAGAAAGG + Intergenic
915849864 1:159309897-159309919 TTTGATATGGATAGAAAGTCCGG + Intergenic
918062758 1:181076284-181076306 TGATACATGGATATTAAGTAGGG - Intergenic
919063123 1:192660156-192660178 TGCTATAAGGATATAAAATGTGG + Exonic
919265399 1:195257081-195257103 TTATATATGTAAATGAAGTAGGG + Intergenic
919545146 1:198907103-198907125 TTCTACAGGGATAAAACGTATGG + Intergenic
920631479 1:207656987-207657009 TTCAATATGGATTTAAAAGAAGG - Intronic
920641964 1:207761112-207761134 TTCAATATGGATTTAAAAGAAGG - Intronic
921875371 1:220189550-220189572 TTCTATCTGAAAATAAAGAAAGG + Intronic
921987258 1:221325815-221325837 GTACATATGGATATAAAGAAAGG - Intergenic
923851603 1:237802360-237802382 TTCTATTTGGATATATATTACGG - Intronic
1064956075 10:20911655-20911677 TTTTATATGTACATAAAATAGGG + Intronic
1066333138 10:34447015-34447037 GTTTATATGGATAGAAAGCAAGG - Intronic
1069195828 10:65550179-65550201 TGATATCTGGATATAATGTAAGG - Intergenic
1069349983 10:67513668-67513690 TTATATATGGCTATAATGAAAGG - Intronic
1070235899 10:74626152-74626174 TTCTATGTGGATTTAAAATGGGG - Intronic
1071669497 10:87595235-87595257 TTATATATGGACATAGTGTAAGG + Intergenic
1072870230 10:99111475-99111497 TTATATAAGGATATACAGCAGGG - Intronic
1073841068 10:107499611-107499633 TTCAATGTGGATATGAACTATGG - Intergenic
1074010021 10:109468767-109468789 TTCTCTAAGCCTATAAAGTAGGG - Intergenic
1074801899 10:117008205-117008227 GTCTCTAGGGATAGAAAGTAGGG + Intronic
1074965343 10:118486500-118486522 TTATGTATGGATACAAAGAAAGG + Intergenic
1074988573 10:118680712-118680734 TTCTATATTCATATATAGTATGG - Exonic
1077401681 11:2361529-2361551 GTCTATTTGGAGATGAAGTACGG + Intergenic
1078027885 11:7715622-7715644 TTGTATATGGTTATAAGGAAGGG + Intergenic
1079449842 11:20590469-20590491 TTCTTTATGGAAACATAGTATGG + Intergenic
1079845713 11:25464284-25464306 TTCTATATTTCTATATAGTAAGG + Intergenic
1079881343 11:25931363-25931385 TTCTTGATGTATATAATGTAGGG + Intergenic
1080184323 11:29462070-29462092 TTCTATTTTTATTTAAAGTAGGG + Intergenic
1081260409 11:40953205-40953227 AACTCTATGGAAATAAAGTAAGG + Intronic
1081394565 11:42570375-42570397 TTCTATATGTAAATAAATTGAGG + Intergenic
1081903575 11:46651023-46651045 TTGTCTGTGGATATAAAGAATGG + Intronic
1085432906 11:76471003-76471025 TTGTATATTGATATGAAGAATGG - Intronic
1085608970 11:77929174-77929196 TTATATATATATATAAAATATGG - Intronic
1085774901 11:79356867-79356889 TTCATTATGGATATATAGTGTGG - Intronic
1086868230 11:92006100-92006122 TTCTTTATGGATAAAAATTCTGG + Intergenic
1087246220 11:95840819-95840841 TGCCATATGAATTTAAAGTAGGG - Intronic
1087382042 11:97417671-97417693 GTATATATGTATATATAGTACGG + Intergenic
1087417318 11:97873376-97873398 TTATATATGGATATAATGTAAGG - Intergenic
1087505570 11:99016524-99016546 TTCTTTATGGTTTTAAAGAATGG - Intergenic
1087515995 11:99161955-99161977 TTCTAAATGGATGTTAGGTAAGG - Intronic
1087517666 11:99184489-99184511 TTTTATATGGGTATGAAGGATGG - Intronic
1088373662 11:109118018-109118040 CTCTATAGGGACATAAAGTGGGG - Intergenic
1090541020 11:127705545-127705567 TGTTATATGTATATAAATTAAGG + Intergenic
1092976343 12:13748774-13748796 TTTTATATGTATTCAAAGTAGGG + Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1095126732 12:38488020-38488042 TTGCATATGGATGTAAATTAAGG + Intergenic
1095569426 12:43666736-43666758 TTTTAAAAGAATATAAAGTATGG + Intergenic
1095580801 12:43795491-43795513 TTCCATGTTGATATAAAGTAGGG - Exonic
1096751683 12:53763247-53763269 ATCTATATGGATAAAAACTCAGG + Intergenic
1097481296 12:60129044-60129066 TTCTTTGTGGATATAAAGAAAGG + Intergenic
1099068718 12:78017996-78018018 TTCCATGTGAATATAAAGCAAGG + Intronic
1099504424 12:83455161-83455183 TTCTACATGGAAAAAAAGTATGG + Intergenic
1100191133 12:92193076-92193098 GAATATATGGGTATAAAGTAAGG + Intergenic
1102372199 12:112391259-112391281 TTTTATATGCATATAAAGATGGG - Intergenic
1103419997 12:120772927-120772949 TTCTATATGATTATAAAGTCAGG - Intronic
1104704868 12:130935700-130935722 TTCTATATCTTTAGAAAGTAAGG - Intergenic
1106239071 13:27894358-27894380 TTCTATCTAGAAATAAAATAGGG - Intergenic
1106595993 13:31138020-31138042 TGCTATAGGGAAACAAAGTAAGG - Intronic
1109402326 13:61850493-61850515 TTATATTTAAATATAAAGTATGG + Intergenic
1109625374 13:64967108-64967130 CTGTATAATGATATAAAGTAGGG + Intergenic
1109710273 13:66150139-66150161 ATCTTTATAGATATAATGTAAGG - Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1110025142 13:70528054-70528076 TACTATATGGATGCAAATTAAGG - Intergenic
1110027332 13:70557359-70557381 TCCTATATGGAAATAAAATTTGG - Intergenic
1110267307 13:73552906-73552928 CTATATATGAATATAAAATAAGG - Intergenic
1110528270 13:76565307-76565329 TTCTATGGGGTTATCAAGTAGGG + Intergenic
1111283545 13:86059952-86059974 TGCTAGATGGAGAAAAAGTATGG - Intergenic
1111367222 13:87264496-87264518 ATCTATATTGATATAAATAAAGG - Intergenic
1113091831 13:106624957-106624979 TTCTATATGGATATAAAAGGAGG + Intergenic
1114843181 14:26289973-26289995 CATTATATGGATAAAAAGTAAGG - Intergenic
1115421580 14:33200960-33200982 TTGTAAATGGATTTAAAGTAAGG - Intronic
1116662047 14:47722748-47722770 ATATATATATATATAAAGTAGGG - Intergenic
1116804258 14:49476532-49476554 TTCTATATAGTTAAAATGTATGG - Intergenic
1117023458 14:51595731-51595753 TTCCATATGGCTATAGACTATGG + Intronic
1118216598 14:63814516-63814538 TTATATATGGATATATATAATGG - Intergenic
1118259020 14:64230381-64230403 ATATATATGGATATATAATATGG + Intronic
1119841032 14:77793215-77793237 TTCAATAAGGGTAAAAAGTATGG - Intergenic
1120074633 14:80141551-80141573 TACTTGATGGATAGAAAGTAAGG - Intergenic
1120240271 14:81941707-81941729 TTATATAAGGAAATAAAATATGG - Intergenic
1121476278 14:94208100-94208122 TTATATATTTTTATAAAGTATGG + Intronic
1125126218 15:36224608-36224630 TTTTATATAAAAATAAAGTATGG + Intergenic
1125128693 15:36255654-36255676 TTCTATATGGTTATCAATTCTGG - Intergenic
1125987576 15:44069987-44070009 TTTTAAATGTATACAAAGTAAGG + Intronic
1128473949 15:67981096-67981118 TTATATATGCATATAATATAAGG - Intergenic
1128817763 15:70626638-70626660 TTCTACATGGGTATATAGCATGG - Intergenic
1134401250 16:13912296-13912318 TTATATATGGATATGAGATAAGG - Intergenic
1141057321 16:80830693-80830715 TTCTAGATGGATATAACCTTGGG + Intergenic
1144198561 17:12918643-12918665 TTCTATATTTATAAAAAGAAAGG - Intronic
1146012012 17:29203329-29203351 TTCCATGTTGATATAAAGTAGGG - Intergenic
1146534364 17:33637377-33637399 TTGTATGTGGACATAAGGTAGGG - Intronic
1147800219 17:43080158-43080180 TTCTTTGTGGATAGGAAGTATGG + Intronic
1153103296 18:1498771-1498793 CTTTATTTGGATATTAAGTATGG - Intergenic
1153350141 18:4070700-4070722 TTCCATATGGATAAAAAGGTTGG + Intronic
1155384306 18:25260389-25260411 TAAAATAGGGATATAAAGTATGG + Intronic
1155682004 18:28499650-28499672 TTATATATAAATATAATGTATGG + Intergenic
1156957296 18:42982541-42982563 TTTTATTTGGACATTAAGTATGG - Intronic
1157213022 18:45760061-45760083 TTCTGTATTTATATAAAATATGG - Intergenic
1158034248 18:53005369-53005391 TCCTATATGGATATTACGTCAGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1159217212 18:65408631-65408653 CTGTATATGAATATAAACTATGG + Intergenic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1159690998 18:71486925-71486947 TTATATATGTATATAAATTTTGG + Intergenic
1160110414 18:76024434-76024456 TTCTTTAAGAATATAAACTATGG + Intergenic
1164756488 19:30693801-30693823 ATCTATATGGATATATACTGTGG + Intronic
1165550184 19:36577258-36577280 TTCTACTTCGATAGAAAGTAGGG - Intronic
1166970241 19:46562079-46562101 TTCTGTCTGGATATTATGTAAGG - Intronic
1167564043 19:50245032-50245054 TTCTATTTTGGTTTAAAGTAAGG - Intronic
928715745 2:34057893-34057915 TTCTAAATGAATATAAGATATGG + Intergenic
928783182 2:34849603-34849625 TTCTAAATGGATATGAATTTTGG - Intergenic
930697928 2:54430763-54430785 TTGTTTATGGACACAAAGTAGGG - Intergenic
930965527 2:57319558-57319580 GTAAATATGGATATAAAGAAGGG + Intergenic
931497750 2:62828819-62828841 TTCTTCATGGAATTAAAGTATGG - Intronic
931528090 2:63180379-63180401 GTACATATGGACATAAAGTATGG - Intronic
931683919 2:64776750-64776772 TTGTATCTGTATATAAAGTGAGG - Intergenic
932016289 2:68030629-68030651 TTCTTAATGGAAATAAAGTTTGG - Intergenic
932087061 2:68771861-68771883 TCCTTTATGGATATAAAACATGG + Intronic
932308553 2:70721313-70721335 GTGAAAATGGATATAAAGTAAGG - Intronic
933434924 2:82236635-82236657 TTCTAGAAAGATATAAATTATGG + Intergenic
936817421 2:116475891-116475913 TTTTATATGGTTAGAGAGTAAGG - Intergenic
937566415 2:123295213-123295235 TTATACATGAATATACAGTATGG - Intergenic
937642913 2:124234170-124234192 TTCTATATATATATAAAATCAGG + Intronic
938102776 2:128508761-128508783 TGTTATATAGATATAAATTAGGG + Intergenic
938786382 2:134633615-134633637 TTCTATAGGGATCTAATCTATGG - Intronic
942890960 2:180987416-180987438 TCCTATATGGAAAGAAATTAGGG - Intronic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943917893 2:193661018-193661040 TTCTATATTGATACAAAATGTGG - Intergenic
945626165 2:212209229-212209251 TTCTATATTGCTATTAAGTAAGG - Intronic
945907768 2:215614314-215614336 TGCAATATTTATATAAAGTACGG + Intergenic
946030225 2:216697837-216697859 TTCTAAGTGGAGATAAAGAATGG - Intergenic
1168788650 20:561168-561190 TTCATTATGAATATAAAGTATGG - Intergenic
1173281231 20:41630025-41630047 TTGTATATGGTTAAAAAGTATGG + Intergenic
1177452827 21:21293772-21293794 ATCTTTTTGGATACAAAGTATGG - Intronic
1178214468 21:30578471-30578493 TTCTATATAGTTATATAGAACGG + Intergenic
1178872722 21:36389635-36389657 TTCTAGATTGTTTTAAAGTATGG - Intronic
1179952760 21:44720062-44720084 TACTATATGGAGAAAAAGCAGGG - Intergenic
949198801 3:1346133-1346155 TTCTGTATGTAAATAAATTAAGG + Intronic
951069943 3:18315737-18315759 TTTTATATGGCTACATAGTATGG + Intronic
951661985 3:25077040-25077062 TTCTGTAGGCATCTAAAGTAGGG + Intergenic
954929652 3:54270308-54270330 TTCTATATTTATATAAGGCAAGG - Intronic
955792536 3:62603491-62603513 TTCTATATGTGCATAAAGTGTGG - Intronic
956583718 3:70841968-70841990 TACTATTTGGATAGAAAGGATGG + Intergenic
958068358 3:88575430-88575452 TTTTATGTGTATATAGAGTAGGG + Intergenic
959437626 3:106336194-106336216 ATATATATGGAAATTAAGTAGGG + Intergenic
959734694 3:109645354-109645376 TTGTATATGCATAGAAAATATGG - Intergenic
960186103 3:114641477-114641499 TCTTATATAGATATAAAATAGGG + Intronic
960308955 3:116097209-116097231 TTCTAGATGGAAAAAAAATATGG + Intronic
961634968 3:128327637-128327659 TTCCACATGGATAAACAGTAGGG + Intronic
962051685 3:131822458-131822480 TTATATATGGATATGAAATTGGG - Intronic
969845179 4:9914745-9914767 TGCTCTAAGGATATAAAGCAAGG - Intronic
971212340 4:24630885-24630907 TTCAATATATATATAATGTATGG - Intergenic
971809238 4:31402273-31402295 TTTTATATATATATAAAATATGG + Intergenic
971945916 4:33277320-33277342 TTTTATATGGATGTACAGTTAGG + Intergenic
972533551 4:39980942-39980964 ATGTATATGAAAATAAAGTAGGG + Intergenic
972887160 4:43506921-43506943 TTCTATAAGGAAATAAGTTAGGG - Intergenic
974583691 4:63840623-63840645 TTCTACTTGTATATAAAGAAGGG - Intergenic
974884154 4:67795468-67795490 TTCTATATGGATTTAAAGCAAGG - Intergenic
975818337 4:78242906-78242928 TTCTATATGAATATAAGATACGG - Intronic
976403344 4:84633624-84633646 TTCTATTTATATATAAATTAAGG + Intronic
976520261 4:86018293-86018315 TTCTATATGCATTTTAAGTTTGG - Intronic
977096977 4:92758825-92758847 TTCTATATAGATGTAAAGATTGG + Intronic
977190834 4:93999041-93999063 TACCATTTAGATATAAAGTAAGG - Intergenic
977378555 4:96239559-96239581 TTCTAGATGGATATACAGATAGG + Intergenic
977848937 4:101800510-101800532 TCCAATATGGATAAAAAGGAAGG - Intronic
978230579 4:106392681-106392703 TTCTATCTGGATATGAAGTAAGG - Intergenic
979182339 4:117746001-117746023 TTCTATGCTGATATAAAGAATGG - Intergenic
980015092 4:127640841-127640863 TTTTATATGATTATAAAGCATGG + Intronic
980718158 4:136655814-136655836 TTTTATATGGATAATAACTAAGG + Intergenic
980807727 4:137835239-137835261 CTTTATATGGAAATTAAGTATGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981084225 4:140666648-140666670 TTCCAAATGGATAAAAGGTATGG + Intronic
981705449 4:147654654-147654676 TTCTATAGTGATCTAAAGAATGG - Intronic
982245033 4:153343011-153343033 TGCTAAATGGATATAAAAAAGGG - Intergenic
982976053 4:162062570-162062592 TTCTATATGGATATAAAGTAAGG - Intronic
983461699 4:168032256-168032278 TTCTATATGTATATGGTGTAAGG + Intergenic
983688952 4:170445044-170445066 ATCTACATGGAAATAAAGGAAGG - Intergenic
984229415 4:177076111-177076133 TTCTATTTTGATATAATGTCTGG + Intergenic
984288666 4:177765237-177765259 TTCTATATGGAATTATAGAATGG + Intronic
984480614 4:180296597-180296619 TTCTGTATGGAAAAAAAATAAGG - Intergenic
987461202 5:18212892-18212914 TTCCATATGGAGATAAGGTTTGG - Intergenic
987552994 5:19408203-19408225 GTATATATGGATACAAAGCAGGG - Intergenic
987907876 5:24102247-24102269 TTCTAAATGGTAATAAAGTTTGG - Intronic
988166721 5:27600176-27600198 TTCTATATTAGTATACAGTAAGG - Intergenic
989242995 5:39221350-39221372 TGCTAGATGGTTATAAAGAAGGG + Intronic
989593326 5:43132047-43132069 TACTATATACATATAAAGCAAGG - Intronic
990484484 5:56244336-56244358 TCCTATCTGGAGATTAAGTATGG + Intergenic
991060676 5:62371724-62371746 TTTTATATGGGTATGAAATAGGG + Intronic
991575047 5:68093887-68093909 TTTTATATGTATATAAAGTGAGG + Intergenic
992000973 5:72436282-72436304 ATATATATATATATAAAGTATGG - Intergenic
992804795 5:80326083-80326105 CTTTATATATATATAAAGTAAGG + Intergenic
993854690 5:93059086-93059108 TTTTATTGGGATATAAAATAAGG - Intergenic
994623129 5:102186973-102186995 TTCTATCTTGATATATAGGAAGG - Intergenic
994926709 5:106125261-106125283 TCCTTAATGTATATAAAGTAAGG + Intergenic
997174364 5:131759069-131759091 TTTTATACGGTTAAAAAGTAAGG - Intronic
999516764 5:152309743-152309765 CTCTTTATGGTAATAAAGTATGG - Intergenic
999890286 5:155971185-155971207 TTCTATAGTGAAAGAAAGTAAGG + Intronic
1000127159 5:158256970-158256992 TCCTGGATGGATATAAAGTGGGG + Intergenic
1001905989 5:175473636-175473658 TCCTATAAGGAAATAAAGAAGGG - Intergenic
1002846314 6:948281-948303 TTCTATGGGAATAGAAAGTATGG + Intergenic
1003347039 6:5279587-5279609 TTTTATATATATATAAAATAAGG + Intronic
1003720928 6:8701298-8701320 TTCCAAATGGATATAAACTCTGG + Intergenic
1004778172 6:18872541-18872563 TTCTATATGAATATTTAGTTGGG + Intergenic
1004950722 6:20668136-20668158 TTCCATATGGATATATACAAAGG + Intronic
1008255636 6:49296432-49296454 TTCCACATGTTTATAAAGTAGGG + Intergenic
1009161998 6:60294531-60294553 GTATATATATATATAAAGTAAGG - Intergenic
1009612187 6:65960517-65960539 TTCTATATAGATCTATAATAGGG - Intergenic
1010256464 6:73764276-73764298 TTCTGTAGGGATTTAAAGCAGGG + Intronic
1010748421 6:79590620-79590642 GTATATACGGATATAAAGAAGGG + Intergenic
1012105264 6:95149312-95149334 TAATACATGGCTATAAAGTATGG - Intergenic
1012634000 6:101512252-101512274 TGGTATATGTATATACAGTATGG + Intronic
1013823501 6:114183520-114183542 TTATATATGTATATAAAATGAGG - Intronic
1013867459 6:114715847-114715869 TTCTTGTTGGATATAAACTAGGG + Intergenic
1014307494 6:119759786-119759808 TTCTGTATGGATTTAAAAAAAGG + Intergenic
1014713205 6:124833581-124833603 TTCTATTTGTATTTAAAGAAAGG + Intergenic
1015473193 6:133629780-133629802 TTTTATTTGGAGATTAAGTATGG + Intergenic
1016755909 6:147686440-147686462 TTTTGTATTGATATAAGGTAGGG + Intronic
1020895118 7:13930035-13930057 TTTTGTCTGGATATAAAGTTTGG - Intronic
1023549609 7:41355537-41355559 TTTTATATGGAAACAAAGCATGG - Intergenic
1024199864 7:47095696-47095718 TCCTTTAAGGATATAATGTACGG + Intergenic
1027732018 7:81886225-81886247 TTCTTTATAGGTAGAAAGTATGG + Intergenic
1030335599 7:108322571-108322593 TTCTAAAAGGATTTAAATTATGG + Intronic
1030432103 7:109462922-109462944 TTCTATATGCTCATAAAGCAAGG + Intergenic
1031047170 7:116904593-116904615 TTCTACATGGATTTAAATCAAGG - Intronic
1031421846 7:121562682-121562704 TTCTATATGAATAGAAACTCAGG - Intergenic
1031778015 7:125925175-125925197 TACTATAGGAATATAAAGAATGG + Intergenic
1031883103 7:127218773-127218795 TTGTCTTTGGAGATAAAGTATGG + Intronic
1032914480 7:136473951-136473973 GTCTATATGGACACAAAGAAGGG - Intergenic
1033753411 7:144377734-144377756 TTCTCTCTGGATTTAAATTAGGG - Intronic
1036080397 8:5549046-5549068 TTCTGAATGGACATGAAGTAGGG + Intergenic
1036424029 8:8626671-8626693 TTCTATTTGGCTATAAAATATGG + Intergenic
1038698834 8:29830580-29830602 TTCTATTTTGATATATAGTCTGG - Intergenic
1039368902 8:36964590-36964612 TTGGATATGGATATAAGGAAAGG - Intergenic
1042982968 8:74551216-74551238 TTCTATCTGGAAAGAAAGCATGG - Intergenic
1043221285 8:77668465-77668487 TTTTATATGAATATGATGTATGG + Intergenic
1043821334 8:84869013-84869035 TTATATATATATATAAAGAAAGG + Intronic
1044001869 8:86892933-86892955 ATTTTTATGGATATAAAGTTTGG + Intronic
1044373462 8:91442100-91442122 TTCTCTATAGATATGAAGTAAGG - Intergenic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1044971597 8:97625272-97625294 TTATATACTTATATAAAGTAAGG + Intergenic
1046066164 8:109199193-109199215 TTTTAAATGAATTTAAAGTATGG + Intergenic
1047038396 8:120965176-120965198 TTTTATTTGGAAATTAAGTATGG - Intergenic
1047059682 8:121210798-121210820 TTCTAAATGGATCTAAGCTATGG - Intergenic
1047453901 8:124991641-124991663 TTTTATTTGGAGATGAAGTATGG + Intergenic
1048809187 8:138269753-138269775 TTCATTATGGAAATTAAGTAAGG - Intronic
1050820138 9:9868549-9868571 TTCTATGTGAATAAAAAGTAGGG + Intronic
1052385661 9:27821049-27821071 TTCCATTTTGTTATAAAGTATGG + Intergenic
1053461607 9:38275824-38275846 TCCTATGTGGATAGAAAATAAGG + Intergenic
1055246522 9:74251433-74251455 ATCTATATGGAAATTAAGTCAGG - Intergenic
1056035855 9:82604635-82604657 TTCTATATGTATATGAATAATGG - Intergenic
1057634664 9:96752986-96753008 TTCTGTATAGATGTTAAGTAAGG + Intergenic
1059072311 9:111151516-111151538 TTATATATTGATATAATATATGG + Intergenic
1186022493 X:5271815-5271837 ATGTATCTGTATATAAAGTATGG - Intergenic
1187034084 X:15519368-15519390 TTCTACATGGATATGAAATTTGG - Intronic
1187358307 X:18599815-18599837 TTCTATATGGATGGAAAATTTGG - Intronic
1188838420 X:34986645-34986667 TTCTATGTGGCTAAAAAGCAAGG - Intergenic
1189392883 X:40591826-40591848 TTCTATATGCTTATAATGGAAGG - Intronic
1190566883 X:51739517-51739539 TTATATATATATATAAAGAAAGG - Intergenic
1192952566 X:76032816-76032838 TTTTACATGGATATGTAGTATGG + Intergenic
1193339179 X:80325587-80325609 TTATATATATATATAAAATAAGG - Intergenic
1193339180 X:80325612-80325634 TTTTATATATATATAAAATAAGG - Intergenic
1193339181 X:80325635-80325657 TTATATATATATATAAAATAAGG - Intergenic
1193339182 X:80325660-80325682 TTTTATATATATATAAAATAAGG - Intergenic
1193339183 X:80325683-80325705 TTATATATATATATAAAATAAGG - Intergenic
1193339184 X:80325708-80325730 TTATATATATATATAAAATAAGG - Intergenic
1193339185 X:80325733-80325755 TTATATATATATATAAAATAAGG - Intergenic
1193339186 X:80325758-80325780 TTTTATATATATATAAAATAAGG - Intergenic
1193339187 X:80325781-80325803 TTATATATATATATAAAATAAGG - Intergenic
1193339188 X:80325806-80325828 TTATATATATATATAAAATAAGG - Intergenic
1193339189 X:80325831-80325853 TTATATATATATATAAAATAAGG - Intergenic
1193339190 X:80325856-80325878 TTATATATATATATAAAATAAGG - Intergenic
1193339191 X:80325881-80325903 TTTTATATATATATAAAATAAGG - Intergenic
1193339195 X:80325967-80325989 TTTTATATATATATAAAATAAGG - Intergenic
1193339196 X:80325990-80326012 TTTTATATATATATAAAATAAGG - Intergenic
1193339197 X:80326013-80326035 TTTTATATATATATAAAATAAGG - Intergenic
1193431800 X:81416039-81416061 TGCAATAAGGATATAAATTATGG + Intergenic
1194649757 X:96500652-96500674 TTTTATATGGAGATTAAGTGTGG + Intergenic
1195124858 X:101798224-101798246 GTACATATGGATATAAAGAAAGG + Intergenic
1195865028 X:109423313-109423335 TTCTATCATGATATAAAATAGGG - Intronic
1196141936 X:112272923-112272945 TGGTATATAGCTATAAAGTAGGG - Intergenic
1196383171 X:115116748-115116770 TTGTATGTGGTTAAAAAGTATGG - Intronic
1197540634 X:127756042-127756064 TTTTATTTGGAGATTAAGTATGG + Intergenic
1197579686 X:128266151-128266173 ATATATATGTATATAAATTAAGG + Intergenic
1199444377 X:147904613-147904635 TGCTAGATGGATATACAATAAGG - Intergenic
1200276174 X:154735087-154735109 TTAGATATGGATATATAGTTTGG - Intronic
1200330368 X:155290261-155290283 TTCCATGTTGATATAAAGTAGGG - Intronic
1200520066 Y:4200768-4200790 TTTTATATAGGTATAAGGTAAGG - Intergenic
1202050081 Y:20771725-20771747 TTCTAAATGGATTCAACGTAAGG - Intronic