ID: 982978057

View in Genome Browser
Species Human (GRCh38)
Location 4:162092220-162092242
Sequence CTGCATGTTTATATGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982978054_982978057 26 Left 982978054 4:162092171-162092193 CCAGTTTTAGAACTGCTTATATA 0: 1
1: 0
2: 1
3: 24
4: 328
Right 982978057 4:162092220-162092242 CTGCATGTTTATATGTTTCCAGG 0: 1
1: 0
2: 2
3: 19
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982978057 Original CRISPR CTGCATGTTTATATGTTTCC AGG Intronic
900816834 1:4853991-4854013 CTGAATATGTATTTGTTTCCTGG + Intergenic
904557874 1:31377043-31377065 CAGCATGTTCAGCTGTTTCCTGG + Intergenic
904630933 1:31841820-31841842 CTTCATCTTTATGTTTTTCCTGG + Intergenic
905863681 1:41365847-41365869 CTGCCTGCTTTTGTGTTTCCTGG + Intronic
905924187 1:41738209-41738231 CTGCTTGTCTATATGTCTCTGGG - Intronic
906856324 1:49309323-49309345 ATGCATTTTTATAGGCTTCCTGG - Intronic
907255604 1:53176366-53176388 CTGCAGGATGAGATGTTTCCTGG - Intergenic
908484162 1:64573697-64573719 GTGCATTTTTATTTGTTGCCTGG - Intronic
908486554 1:64599907-64599929 CTCCAGGTTTATACATTTCCTGG + Intronic
908920170 1:69180889-69180911 CTGCAACATTATATCTTTCCCGG - Intergenic
909884818 1:80927942-80927964 CTGCAAATTTATGTGTTTCTAGG + Intergenic
911245019 1:95507355-95507377 CTCCATGTTTTTATATTTCCAGG - Intergenic
912081298 1:105940290-105940312 ATACATTTTTATATGTTTCATGG + Intergenic
912761340 1:112370249-112370271 CTTCATTTTTCTGTGTTTCCTGG - Intergenic
912854429 1:113154429-113154451 GAGTATGTTTTTATGTTTCCTGG - Intergenic
913010301 1:114676765-114676787 TTGGGTGTTTATATGTTTTCTGG - Intronic
914422248 1:147540173-147540195 CTGCATGTTTCAATCTTTCTGGG + Intergenic
917234926 1:172881339-172881361 CTGGGAGATTATATGTTTCCAGG + Intergenic
920384130 1:205555902-205555924 CTGATTTTTTCTATGTTTCCAGG + Intergenic
920431099 1:205919726-205919748 CTGCATATTTATATGTTCCCTGG + Intronic
920644059 1:207784722-207784744 CTCCATGATTATAAGTTTCCTGG - Intronic
921907702 1:220512749-220512771 CTGCATGTTTACAAGCTTCTTGG - Intergenic
923996401 1:239500005-239500027 TTCCATTTTGATATGTTTCCAGG - Intronic
1063179126 10:3581517-3581539 CTGGATGCTTATATGTATACAGG + Intergenic
1063277943 10:4591828-4591850 CTTAGTATTTATATGTTTCCAGG + Intergenic
1064466712 10:15590149-15590171 CTGCATCTTTATATTTTTTAAGG + Intronic
1064490386 10:15849758-15849780 ATAAATGTTTATATGCTTCCTGG - Intronic
1066573972 10:36805156-36805178 CAGCATGTTTTTGTTTTTCCTGG - Intergenic
1068173788 10:53429839-53429861 CTGCATTTTAACATGTGTCCAGG + Intergenic
1068266799 10:54660381-54660403 TTGGCTGGTTATATGTTTCCAGG - Intronic
1068934232 10:62620552-62620574 GTGCATGTTTGTGTGTGTCCAGG - Intronic
1069736924 10:70662571-70662593 CTGCTTGTTTATGTGTTCCATGG - Intergenic
1071081560 10:81818488-81818510 GTGCACTTCTATATGTTTCCAGG + Intergenic
1071495546 10:86165308-86165330 CTGCAAGTTTCTATGTTGCTCGG + Intronic
1071557399 10:86615281-86615303 CTGGATGTTTATTTGTTGCTGGG - Intergenic
1072742227 10:97916270-97916292 CTGCATGTTTATTTCTTTTCCGG + Intronic
1072841672 10:98781594-98781616 ATGTATTTTTATATGTTTCTTGG - Intronic
1074394382 10:113085467-113085489 GTTCATTTTTAAATGTTTCCTGG + Intronic
1074570533 10:114620262-114620284 ATGCATGTGTATATGAATCCTGG + Intronic
1074642760 10:115406351-115406373 CAGTATTCTTATATGTTTCCTGG + Intronic
1074955043 10:118380402-118380424 CTGCATAAGTAAATGTTTCCTGG + Intergenic
1078258288 11:9680132-9680154 CTGCATGTTTTTTTCTTCCCAGG - Intronic
1079418977 11:20268425-20268447 CTGAATATTTTTATGTATCCAGG + Intergenic
1079814919 11:25043554-25043576 CTGCAAGGATATATGTATCCAGG + Intronic
1080758153 11:35221902-35221924 CTGCATCTTAACAAGTTTCCAGG + Intronic
1083504719 11:63145350-63145372 CTGCATCTTAAGATGTTTCACGG - Intronic
1085411500 11:76293459-76293481 GTGCATATTTATATGGTTCGCGG + Intergenic
1087383234 11:97435725-97435747 CTGGATGTTTATATCTATCATGG + Intergenic
1087569003 11:99899958-99899980 CTGGAAGTTTGTATGTTTACAGG + Intronic
1087862894 11:103184826-103184848 CTGTATGGTTCTATGTTTACTGG + Intronic
1087991922 11:104754982-104755004 GTGAATGTTTAAATGTTTCATGG - Intergenic
1088508061 11:110545688-110545710 TTGGAAGGTTATATGTTTCCAGG - Intergenic
1088612287 11:111589444-111589466 CTGGATGTATATCTGTTGCCTGG - Intergenic
1090271020 11:125386353-125386375 CTGCATTTTAAAAAGTTTCCTGG + Intronic
1091680889 12:2525659-2525681 CTGCATGATTAAATGCCTCCTGG + Intronic
1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG + Intergenic
1093527650 12:20121171-20121193 CTGCTTGTTTTTATTTTGCCTGG - Intergenic
1093934675 12:24988022-24988044 CTGCATGTTTGCATGTTTATGGG - Intergenic
1095621897 12:44266403-44266425 GGCCATGTTTATATCTTTCCTGG + Intronic
1095632153 12:44390593-44390615 CAACATGTTTATGTGTTTCTAGG + Intergenic
1096603936 12:52751533-52751555 CAGCATGTTTACATGGTTACAGG + Intergenic
1098995762 12:77117666-77117688 CTGCTTGTTTATATTCTTCCTGG + Intergenic
1099927326 12:89033518-89033540 GTGCATGTTTTTATGTGTCTTGG - Intergenic
1101097501 12:101357922-101357944 CTGCATTTTCATATGATCCCTGG + Intronic
1102237747 12:111304846-111304868 CTGCCTGTTGATATGTTGGCTGG - Intronic
1102733655 12:115137827-115137849 CTCCAGGTTTATATCTTTCTAGG + Intergenic
1102817509 12:115879652-115879674 CTGCATTTTTACAAGCTTCCTGG - Intergenic
1104424240 12:128661576-128661598 CTCCATGTGCATATGTATCCAGG - Intronic
1104497559 12:129255145-129255167 CTGCATGATTCTAAGTTTCCTGG + Intronic
1105453891 13:20523738-20523760 CTGCTTGTTTCTTTGTTTTCTGG - Intronic
1106175424 13:27326636-27326658 CTGCATATTTATATGTCTTTTGG + Intergenic
1106363407 13:29053001-29053023 CTTCATGATTGTAAGTTTCCTGG + Intronic
1106510630 13:30409418-30409440 CTGCTTGTTTATGTGTTTACAGG - Intergenic
1106870099 13:34009948-34009970 CTACATATTTAGGTGTTTCCGGG - Intergenic
1108619603 13:52168523-52168545 CTGAAAGTTTAAATTTTTCCTGG + Intergenic
1108982520 13:56536569-56536591 TTGAATATTTATATGCTTCCTGG + Intergenic
1110509298 13:76329918-76329940 GTGCATGTGTGTATGTTTTCAGG - Intergenic
1111107940 13:83670238-83670260 CACCATGATTGTATGTTTCCTGG + Intergenic
1111873142 13:93859821-93859843 CTTCAAGTTCATATATTTCCAGG - Intronic
1112053419 13:95667900-95667922 CTGCCATTTTATTTGTTTCCTGG + Intergenic
1112704595 13:102052359-102052381 CTGGATATTTATATTTTTCCTGG - Intronic
1113596766 13:111539341-111539363 AGGCATGTTTGTATGGTTCCTGG - Intergenic
1113618351 13:111696587-111696609 CTGCATTATGAGATGTTTCCAGG - Intergenic
1113623882 13:111781848-111781870 CTGCATTATGAGATGTTTCCAGG - Intergenic
1115373468 14:32646013-32646035 GTGCATGCTTCCATGTTTCCAGG - Intronic
1116049973 14:39790445-39790467 CTGCAAGTTTATTAGTTTCAGGG + Intergenic
1116161160 14:41268246-41268268 CTGCATGGGTATATCTATCCTGG + Intergenic
1117227960 14:53682596-53682618 CTTGATGTTTGTATTTTTCCTGG + Intergenic
1117622006 14:57597065-57597087 CTGAATGTTTATATTTGTCAGGG - Intronic
1117744053 14:58849751-58849773 CTGCTGGTTTTTATCTTTCCAGG + Intergenic
1119176534 14:72572301-72572323 CTGTATGTTTTTATTTCTCCTGG - Intergenic
1119433362 14:74582802-74582824 CTGCATGTTGACAAGTTCCCAGG + Intronic
1119453298 14:74731297-74731319 CAGCATGTTAGTATGTTTCTAGG + Intronic
1120347199 14:83306321-83306343 GTTCATGTATATTTGTTTCCAGG + Intergenic
1121772025 14:96553924-96553946 CTTCATGTGTATATGTTTTTAGG + Intronic
1124551027 15:30681579-30681601 CTGCCTATGTATATATTTCCTGG - Intronic
1124628109 15:31321332-31321354 CTGCATGTTTGTGTTTCTCCAGG - Intergenic
1124680227 15:31724089-31724111 CTGCCTATGTATATATTTCCTGG + Intronic
1125145397 15:36461551-36461573 GAGCATTTTTATATGTTTCTTGG + Intergenic
1125953258 15:43771936-43771958 CTGCATGTTTATATCTCCCAAGG + Exonic
1126535070 15:49752374-49752396 CTACATGCTAATATGTTTTCAGG - Intergenic
1127183647 15:56453075-56453097 CAGCATGTTTCTTTGTTTCCAGG + Intronic
1127380251 15:58424754-58424776 CTTCTTATTTTTATGTTTCCTGG - Intronic
1128860652 15:71068537-71068559 CGCCATGATTATAAGTTTCCCGG + Intergenic
1129393099 15:75230293-75230315 CTGGATTCTTATTTGTTTCCTGG - Intergenic
1129913091 15:79244471-79244493 CCGCATGTGCCTATGTTTCCAGG + Intergenic
1130320968 15:82840903-82840925 CTAAATATTTAAATGTTTCCAGG + Intronic
1130730745 15:86489465-86489487 TTGCTTATTTATATGTTTTCTGG - Intronic
1130890719 15:88131761-88131783 CTGGATGTATAAATGCTTCCAGG - Intronic
1132947476 16:2539661-2539683 ATTCATGTTTTTATGTTACCCGG - Intronic
1133142226 16:3754387-3754409 CTAAATCTTTATGTGTTTCCAGG - Intronic
1133781716 16:8944157-8944179 TTGCATGTTTGAATGTTTCCGGG + Intronic
1134374500 16:13659259-13659281 CTGCATCTGTATCTGTGTCCAGG - Intergenic
1134902633 16:17952539-17952561 CTGCATTTTTTTAAGTTTCTAGG + Intergenic
1135115957 16:19723643-19723665 CTGCATTTTAACATGTATCCAGG - Intronic
1136489326 16:30595847-30595869 ATGCATGTTGAAATGTTTACGGG + Intergenic
1138828367 16:60348932-60348954 GTGCATGTATATATGTGTCTAGG + Intergenic
1140941982 16:79730410-79730432 CTGCATGGTCATATCCTTCCAGG - Intergenic
1145719238 17:27053239-27053261 TTGGGAGTTTATATGTTTCCAGG - Intergenic
1146059092 17:29595178-29595200 CTGTTTGTTCATCTGTTTCCTGG - Intronic
1146408196 17:32558046-32558068 TTGCATTTTTATATGTTTAAGGG - Intronic
1147657863 17:42101002-42101024 ATGCATGTTAAAATGTATCCAGG + Intergenic
1154469902 18:14690096-14690118 TTGGGGGTTTATATGTTTCCAGG + Intergenic
1155098343 18:22582299-22582321 ATGTATTTTTATATGTTTCTTGG + Intergenic
1155690319 18:28613849-28613871 CTGTATGTTTATAATTTTCTTGG + Intergenic
1155872705 18:31047039-31047061 CTGTATGTTCACATGTCTCCAGG + Intergenic
1155980540 18:32175050-32175072 CTGCATTTTAATATGTTTGATGG - Intronic
1156238571 18:35228900-35228922 CTCCATGATTTTAAGTTTCCTGG + Intergenic
1156249506 18:35338919-35338941 CTGCAGTTTTACATGTTTCATGG - Intronic
1156879395 18:42058888-42058910 GAGCATGTATGTATGTTTCCTGG - Intronic
1157490997 18:48123621-48123643 CTGCATGTTAAACTGCTTCCTGG + Intronic
1160127259 18:76187310-76187332 CTGCCTTTTTATGTCTTTCCAGG - Intergenic
1161166234 19:2789283-2789305 CTGCACGGTTAGGTGTTTCCAGG + Intronic
1168508059 19:56952875-56952897 ATACATGTTTATATGTTTTGGGG - Intergenic
926456816 2:13076807-13076829 CAGGATGCTCATATGTTTCCTGG + Intergenic
926969539 2:18452974-18452996 CTGCATTTTTATAATGTTCCAGG - Intergenic
928570248 2:32599717-32599739 TTGTATGTTTATATATATCCAGG + Exonic
928982369 2:37149509-37149531 CTACATGTTTATATTGGTCCAGG - Intronic
929522001 2:42661573-42661595 CTACCTGTATATATTTTTCCTGG + Intronic
929707481 2:44228854-44228876 CTGCATGCTTAAATGTTTACAGG - Intronic
932103151 2:68919282-68919304 CTGCATTTTTATATACATCCAGG - Intergenic
932250273 2:70237484-70237506 TTGCTTGTTTCTACGTTTCCAGG + Intronic
935161877 2:100536395-100536417 CTTTATATTTATATGTTGCCAGG - Intergenic
936249688 2:110858465-110858487 CTGCATGTTAATAGATTTCTGGG + Intronic
936655517 2:114481812-114481834 CTGCCTGATTATAAGTTTCCAGG - Intronic
938078344 2:128354127-128354149 CTGTATGTTGAGATGTTTCTTGG - Intergenic
941242891 2:163062973-163062995 ATTCATGTTTACAAGTTTCCAGG - Intergenic
942941916 2:181628867-181628889 CAGCATAATTATATGTATCCTGG - Intronic
944304465 2:198163924-198163946 CTGCATGTTTATATTTTACTTGG - Intronic
945340283 2:208644507-208644529 TTCCATGTTTATGTCTTTCCTGG + Intronic
945822491 2:214681643-214681665 ATGCATCCTTATATGATTCCAGG - Intergenic
947564365 2:231184680-231184702 CTGCATTTTTCTATGCTTTCTGG + Intergenic
1169190046 20:3652976-3652998 CTACATCTTTATTTATTTCCAGG - Intergenic
1169743180 20:8917366-8917388 CTATATTTTTATGTGTTTCCAGG - Intronic
1172045942 20:32080125-32080147 CTGGATGTTTCTTTGTTTTCAGG - Intronic
1172860822 20:38049777-38049799 CTGCCTGCATACATGTTTCCTGG + Intronic
1172908899 20:38391172-38391194 ATGCATGCTTATATGTGTACAGG + Intergenic
1174823869 20:53751147-53751169 CTGCATGCTGTTATATTTCCTGG + Intergenic
1174930537 20:54809124-54809146 CTGCATTTCTGTAAGTTTCCAGG - Intergenic
1175922758 20:62457831-62457853 CTGCATTCTTACATCTTTCCAGG + Intergenic
1176804601 21:13467768-13467790 TTGGGAGTTTATATGTTTCCAGG - Intergenic
1178561689 21:33643706-33643728 CTGCATGTATCTAAATTTCCAGG - Intronic
1179362568 21:40726121-40726143 TTGAATGTTTATTTTTTTCCTGG - Intronic
1181320439 22:22001452-22001474 ATGCATTTTTATATGTTTATTGG - Intergenic
1181329949 22:22082557-22082579 CTGCATGTTTTCATGTTTGCTGG - Intergenic
1182252177 22:29009692-29009714 GTTCATTTTTTTATGTTTCCTGG - Intronic
949331163 3:2924157-2924179 CTCCATCTTTATTTGTTTCTAGG + Intronic
949805112 3:7946296-7946318 CTGCATGTTTATATGTACTAAGG - Intergenic
951696801 3:25453549-25453571 CTGCATTTTAACAAGTTTCCAGG + Intronic
952790929 3:37200262-37200284 CTGCATGTTTGTATGTTGGGTGG - Intergenic
953495282 3:43380948-43380970 CGCCATGATTGTATGTTTCCTGG - Intronic
954521565 3:51231518-51231540 CAGCATTTTTATATGTTTATTGG + Intronic
956496948 3:69837755-69837777 TTGAATATTCATATGTTTCCCGG + Intronic
956624449 3:71253040-71253062 CTTCATGGCTATCTGTTTCCAGG + Intronic
957940785 3:87001034-87001056 CTGCTTGTTTATATTTTCCTTGG + Intergenic
959169510 3:102828232-102828254 CTTCACGTTTAAATATTTCCTGG + Intergenic
961005721 3:123404110-123404132 CTGCTTTGTTAAATGTTTCCTGG - Intronic
961739827 3:129026273-129026295 GGGCCTGTTTAAATGTTTCCTGG - Intronic
962406588 3:135105801-135105823 TTGCATTTTGATATGCTTCCGGG - Intronic
962931100 3:140037174-140037196 ATGCATGTTTGAAAGTTTCCGGG - Intronic
962984251 3:140520375-140520397 CACCATGATTATAAGTTTCCTGG - Intronic
963326040 3:143864336-143864358 CTGCATTTTAACAGGTTTCCAGG - Intergenic
963760926 3:149286552-149286574 ATGCATCTTTTTTTGTTTCCTGG - Intergenic
964235092 3:154516226-154516248 CTGTATGTATATAAGTTTCCTGG - Intergenic
966421862 3:179741847-179741869 GTACATGTTTTTATGTTTCCAGG + Intronic
967087844 3:186110221-186110243 TTGTTTGTTTATTTGTTTCCTGG - Intronic
968033594 3:195525797-195525819 CTGCCAGTTTATACATTTCCTGG + Intronic
968761565 4:2444921-2444943 CTGCGTCTGTATATGTTTCAGGG + Intronic
970215912 4:13760411-13760433 CTGTATGTTTTTATGGTTGCAGG + Intergenic
970290835 4:14570490-14570512 ATGCATGTTTATATGGCACCAGG + Intergenic
971462175 4:26911632-26911654 CTGCATTTTTATAGCATTCCTGG + Intronic
971551206 4:27958310-27958332 CTTGATGTTTATATGTGTGCTGG - Intergenic
971721475 4:30250578-30250600 TTGGAGGGTTATATGTTTCCAGG + Intergenic
971841095 4:31852889-31852911 AGGCATCTTTATATGGTTCCTGG - Intergenic
973117156 4:46476029-46476051 CTGCATTTTAAAATGTTACCTGG + Intergenic
974102805 4:57436419-57436441 CAGCGTATTTCTATGTTTCCTGG - Intergenic
974592799 4:63975634-63975656 CTGCATGTTTATATTATTCGTGG + Intergenic
974889651 4:67865735-67865757 CTACCTGGTTACATGTTTCCAGG - Intronic
975097473 4:70474200-70474222 GTCCATATTTATAGGTTTCCTGG - Intronic
975189407 4:71442418-71442440 TTGCATGTTAACATTTTTCCAGG + Intronic
975807958 4:78132877-78132899 CTGCGTGTTTACATGTTTAGAGG + Intronic
976407510 4:84676840-84676862 CTCCATGTTTTTATGCTTTCAGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978339317 4:107705463-107705485 CGCCATGATTATAAGTTTCCTGG + Intronic
979471468 4:121103049-121103071 CTGCAAGATTGTATGTTTCTAGG + Intergenic
980088111 4:128412929-128412951 TTGGGTGTTTGTATGTTTCCAGG + Intergenic
981122809 4:141072005-141072027 CTGCATTTTAACAAGTTTCCAGG - Intronic
981973755 4:150697548-150697570 ATACATGTTTATATTTTTCTTGG + Intronic
982978057 4:162092220-162092242 CTGCATGTTTATATGTTTCCAGG + Intronic
982990505 4:162267824-162267846 TTGGAAGATTATATGTTTCCAGG + Intergenic
983424569 4:167566963-167566985 CTGAATTTTTATAAGTTTCTTGG - Intergenic
983905616 4:173178611-173178633 CGGCATGTTTAAATGCTTCTTGG - Intronic
988345620 5:30034745-30034767 CTGCATGATTGTAAGTTTCCTGG + Intergenic
989539564 5:42603378-42603400 CTGGATGTTTATTTTCTTCCCGG + Intronic
990683619 5:58274578-58274600 CTGCCTTTTTAAATGTTTTCTGG - Intergenic
991257717 5:64633387-64633409 ATGGATATTTGTATGTTTCCAGG + Intergenic
993074445 5:83210960-83210982 CTACATCTTTATATGTTTGGGGG + Intronic
993585308 5:89718768-89718790 CTACATGTTTCTATATTTTCTGG - Intergenic
993942263 5:94073735-94073757 CTGCATGCTTGTATGTTGCTGGG - Intronic
994676756 5:102832754-102832776 TTTCATGTGAATATGTTTCCTGG - Intronic
995083957 5:108086298-108086320 CTGTCTGTTTAGATTTTTCCCGG - Intronic
996590204 5:125138326-125138348 CTGAATGTTTATATCTGTTCAGG + Intergenic
996772141 5:127097103-127097125 CAGCATTTTAATATGTTTTCAGG + Intergenic
997895036 5:137708838-137708860 CTGCATTCTTGTCTGTTTCCTGG - Intronic
998945413 5:147334479-147334501 CTCCATGTTTATCTGATACCAGG - Intronic
1000237351 5:159374436-159374458 TTGGAAGGTTATATGTTTCCAGG + Intergenic
1001967170 5:175918744-175918766 CTGTTTGTTTATTTGTTTTCTGG - Intronic
1002249763 5:177920468-177920490 CTGTTTGTTTATTTGTTTTCTGG + Intergenic
1003117106 6:3290244-3290266 CTGCATGTTTAGATTTGCCCAGG - Intronic
1003705541 6:8524329-8524351 CTGCATGTTTACAGGATTCCTGG - Intergenic
1006406217 6:33847247-33847269 CTGCATTTTAATAAGTTCCCTGG + Intergenic
1008033922 6:46726316-46726338 TTACATGTTAATATGGTTCCTGG - Intronic
1008133281 6:47742387-47742409 ATGCATGTTTATATATATACAGG - Intergenic
1008660386 6:53661675-53661697 CTACATGTTAATATGTGACCTGG - Intronic
1008685232 6:53919060-53919082 CTGCAGGATTACCTGTTTCCAGG - Intronic
1009896492 6:69756957-69756979 CTGAATGCTTGTATGTTTTCAGG - Intronic
1010537459 6:77048658-77048680 TTGAATGTTTATAATTTTCCAGG - Intergenic
1012153858 6:95791574-95791596 CTGCATATTGATAATTTTCCAGG + Intergenic
1014085687 6:117340449-117340471 GTGCATGTTTGTATATTTCTGGG - Intronic
1014697758 6:124645177-124645199 CTGCATGTTCATAAGTTTTTGGG - Intronic
1015596810 6:134874245-134874267 CTGCATCTGGATAAGTTTCCAGG - Intergenic
1017081372 6:150672125-150672147 CTGCATATTTTTTTGTGTCCTGG - Intronic
1017556645 6:155578794-155578816 CTGCATGGTGATAGTTTTCCTGG + Intergenic
1018102074 6:160449297-160449319 CTTCATGTTTATATGTTAGTTGG - Intronic
1018847506 6:167565872-167565894 TTGCATGAGTTTATGTTTCCAGG - Intergenic
1019101122 6:169631088-169631110 CTCCATGTTTCTGTGTTTTCTGG - Intronic
1020653687 7:10905307-10905329 CTGCCTGTTTCCATGTTTCAGGG + Intergenic
1020722310 7:11762492-11762514 GAGCATTTTTATATGTTTGCTGG + Intronic
1021998739 7:26204524-26204546 CTGCATGTTTTTGTATTTCAGGG + Intronic
1022350320 7:29562034-29562056 ATGCATTTTTATATATTTCTCGG - Intergenic
1022478208 7:30725846-30725868 CAGCATGCTTTTATGCTTCCAGG + Intronic
1023138638 7:37079166-37079188 CAGCATGTTTATATGCTCCTGGG - Intronic
1025817601 7:64931032-64931054 CTGAGTCTTTATATGTTTGCAGG - Intergenic
1028617702 7:92788298-92788320 CTGCAAGTTTATCTATTTCAAGG + Intronic
1028654139 7:93183578-93183600 CGGCATGTTTATATGACTTCTGG + Intergenic
1029953286 7:104609635-104609657 CTGCATGTTTAACTGTTTTATGG - Intronic
1030007721 7:105135051-105135073 CAGCATTTTTATATTTATCCTGG - Intronic
1031350148 7:120721288-120721310 CTTCATGTATATATTTTTTCTGG + Intronic
1031357520 7:120805428-120805450 CTGCATTTTGATATATTTCAAGG - Intronic
1031713030 7:125073063-125073085 GTGCATTTTTATAAGTTCCCAGG - Intergenic
1031942029 7:127799124-127799146 CTGCATGGTTATAAGCTCCCAGG + Intronic
1031988271 7:128178027-128178049 CTGAATGTGTTTTTGTTTCCAGG - Intergenic
1032381930 7:131493691-131493713 CTGCATGTTGAAATGTTTTATGG - Exonic
1032648384 7:133851241-133851263 TTGCTTATTTATGTGTTTCCTGG - Intronic
1032966135 7:137100862-137100884 CTGCATGGTTATGAGTTTTCAGG + Intergenic
1034634975 7:152559976-152559998 TTGCCTGTTTATGTGTTGCCTGG - Intergenic
1037224882 8:16574155-16574177 CTGTATTCTTATATTTTTCCTGG + Intergenic
1037713424 8:21374987-21375009 CTGTATTTTGATGTGTTTCCAGG + Intergenic
1038574169 8:28689808-28689830 CTGCAAGTTTATATGCTTAAAGG - Intronic
1042065599 8:64872031-64872053 CTGAATATTTAAATGTTACCAGG - Intergenic
1042154611 8:65829932-65829954 CTCCATGCTGATATGCTTCCAGG - Intronic
1043103548 8:76079307-76079329 CTGCATGTTTATTTTAATCCTGG + Intergenic
1044634796 8:94311569-94311591 CTGTATGTCTAGAAGTTTCCTGG + Intergenic
1046581237 8:116095047-116095069 TAGCATGTTTGTATGTTGCCAGG - Intergenic
1048851462 8:138649405-138649427 CTGAATGAGTGTATGTTTCCAGG + Intronic
1049120893 8:140736319-140736341 CTTCATGTCCATATGTATCCAGG - Intronic
1050290990 9:4154540-4154562 TAGAATGTTAATATGTTTCCTGG - Intronic
1052889236 9:33682289-33682311 CTGCATGTACTTTTGTTTCCTGG + Intergenic
1055213725 9:73832966-73832988 AAGCATTTTTATATTTTTCCTGG - Intergenic
1055896344 9:81180419-81180441 CTCCATGAATATTTGTTTCCAGG + Intergenic
1056280208 9:85034485-85034507 CTGCAGGTTTGTATTGTTCCTGG + Intergenic
1056914358 9:90732077-90732099 CTGCAGGTTCATATTTTTTCTGG - Intergenic
1058103656 9:100945451-100945473 CTTCATGCTTACATCTTTCCTGG + Intergenic
1058773073 9:108257583-108257605 TTGAATGTTAACATGTTTCCAGG - Intergenic
1059579177 9:115525150-115525172 CTGCATGATTAGATTTTTCTAGG - Intergenic
1059637367 9:116183995-116184017 CTGCAGGTTTTTATTTTGCCAGG - Intronic
1061147373 9:128807938-128807960 CTACAGGTTTCTATGTGTCCCGG - Exonic
1061771925 9:132931565-132931587 CCCAATGTTTATATTTTTCCTGG - Intronic
1185757037 X:2660353-2660375 GTTAATGTTTAAATGTTTCCTGG + Intergenic
1188174632 X:26974447-26974469 CAACATGTATATTTGTTTCCAGG - Intergenic
1189755095 X:44262778-44262800 CTGCATGTACAAATGTTACCTGG - Intronic
1190655972 X:52612403-52612425 CTGCCTTTTGCTATGTTTCCAGG + Intergenic
1190709543 X:53056741-53056763 ATGAATGTGTATATATTTCCCGG + Intronic
1191184777 X:57598081-57598103 TTGCTTTCTTATATGTTTCCTGG - Intergenic
1191733344 X:64362955-64362977 CTTCATGGTTATATGCTTCTGGG - Intronic
1191874541 X:65782054-65782076 CTGGTAGCTTATATGTTTCCAGG + Intergenic
1193012474 X:76692269-76692291 CTTGATTTTTATATGTTTACAGG - Intergenic
1193163064 X:78250526-78250548 TTGGAAGATTATATGTTTCCAGG + Intergenic
1194473412 X:94326731-94326753 CAGTATGTTTATTTATTTCCAGG + Intergenic
1194601919 X:95932045-95932067 CTGCATGTGTCTATGTGTACAGG + Intergenic
1195247575 X:103008785-103008807 CTTCAGTTTTATATGTTTCAGGG - Intergenic
1195877102 X:109552852-109552874 CTGCATGCTTTCCTGTTTCCTGG + Intergenic
1196972849 X:121128632-121128654 CTGAATGTTTAAATGAATCCTGG + Intergenic
1196972855 X:121128710-121128732 CTGAATGTTTAAATGAATCCTGG + Intergenic
1199085805 X:143629625-143629647 CTGCCTGTTTACATCTTTTCCGG - Exonic
1201057153 Y:10006121-10006143 CTGGATGTCTTTATATTTCCAGG - Intergenic
1201235983 Y:11912295-11912317 CTGCCTATGTATATTTTTCCAGG - Intergenic
1201542299 Y:15119026-15119048 GAGCATTTTTATATGTTTGCTGG - Intergenic
1201965699 Y:19732276-19732298 CTGCATTTTCATATGTTTCCAGG + Intronic