ID: 982983236

View in Genome Browser
Species Human (GRCh38)
Location 4:162168452-162168474
Sequence GTCCACATTTAACATCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982983236_982983239 15 Left 982983236 4:162168452-162168474 CCTTAGGGATGTTAAATGTGGAC No data
Right 982983239 4:162168490-162168512 AATCATTTTTTCCTTGGCTTAGG No data
982983236_982983238 9 Left 982983236 4:162168452-162168474 CCTTAGGGATGTTAAATGTGGAC No data
Right 982983238 4:162168484-162168506 TAAGTAAATCATTTTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982983236 Original CRISPR GTCCACATTTAACATCCCTA AGG (reversed) Intergenic